Incidental Mutation 'R0511:Slc4a10'
ID46867
Institutional Source Beutler Lab
Gene Symbol Slc4a10
Ensembl Gene ENSMUSG00000026904
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter-like, member 10
SynonymsNCBE
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62046462-62326730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62286862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 722 (V722M)
Ref Sequence ENSEMBL: ENSMUSP00000108099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]
Predicted Effect probably damaging
Transcript: ENSMUST00000054484
AA Change: V692M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: V692M

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 9e-107 PFAM
Pfam:HCO3_cotransp 445 959 1e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102735
AA Change: V692M

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: V692M

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 2e-106 PFAM
Pfam:HCO3_cotransp 445 959 2.4e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112480
AA Change: V722M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: V722M

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 435 9.6e-108 PFAM
Pfam:HCO3_cotransp 476 989 1.5e-245 PFAM
transmembrane domain 997 1019 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155219
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Slc4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Slc4a10 APN 2 62290001 missense probably damaging 1.00
IGL00990:Slc4a10 APN 2 62286940 missense probably damaging 1.00
IGL01294:Slc4a10 APN 2 62253309 critical splice acceptor site probably null
IGL01628:Slc4a10 APN 2 62268666 missense probably damaging 1.00
IGL01773:Slc4a10 APN 2 62190757 missense probably damaging 0.97
IGL02119:Slc4a10 APN 2 62228670 missense probably damaging 1.00
IGL02125:Slc4a10 APN 2 62268171 missense probably benign 0.02
IGL02406:Slc4a10 APN 2 62190769 missense probably benign 0.37
IGL02890:Slc4a10 APN 2 62286916 missense probably damaging 1.00
IGL02959:Slc4a10 APN 2 62268143 missense probably damaging 1.00
IGL02979:Slc4a10 APN 2 62288747 missense probably null 1.00
IGL03144:Slc4a10 APN 2 62250466 missense probably benign 0.00
IGL03175:Slc4a10 APN 2 62296960 missense probably damaging 0.99
IGL03383:Slc4a10 APN 2 62267436 missense probably damaging 1.00
IGL03412:Slc4a10 APN 2 62250543 splice site probably benign
R0085:Slc4a10 UTSW 2 62244346 splice site probably benign
R0401:Slc4a10 UTSW 2 62190848 missense probably benign 0.27
R0433:Slc4a10 UTSW 2 62289983 missense probably benign 0.01
R0482:Slc4a10 UTSW 2 62297017 splice site probably benign
R0506:Slc4a10 UTSW 2 62250533 missense probably benign 0.13
R0590:Slc4a10 UTSW 2 62190893 splice site probably benign
R0883:Slc4a10 UTSW 2 62243398 missense probably benign 0.11
R1167:Slc4a10 UTSW 2 62228574 missense probably damaging 1.00
R1276:Slc4a10 UTSW 2 62250443 missense probably damaging 0.99
R1395:Slc4a10 UTSW 2 62313286 missense probably benign 0.00
R1455:Slc4a10 UTSW 2 62286930 missense probably damaging 1.00
R1589:Slc4a10 UTSW 2 62257462 missense probably damaging 1.00
R1677:Slc4a10 UTSW 2 62324727 missense probably benign
R1848:Slc4a10 UTSW 2 62316606 missense probably damaging 1.00
R1987:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R1988:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R2018:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2019:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2407:Slc4a10 UTSW 2 62313343 missense probably benign
R4067:Slc4a10 UTSW 2 62046645 start codon destroyed probably benign 0.00
R4184:Slc4a10 UTSW 2 62317442 intron probably benign
R4255:Slc4a10 UTSW 2 62281936 missense probably benign 0.10
R4282:Slc4a10 UTSW 2 62244343 splice site probably null
R4296:Slc4a10 UTSW 2 62234428 missense possibly damaging 0.80
R4361:Slc4a10 UTSW 2 62243385 missense probably benign 0.00
R4596:Slc4a10 UTSW 2 62296858 missense probably damaging 1.00
R4709:Slc4a10 UTSW 2 62257517 missense probably null 1.00
R4755:Slc4a10 UTSW 2 62296988 missense probably damaging 1.00
R4836:Slc4a10 UTSW 2 62268187 missense probably damaging 1.00
R4841:Slc4a10 UTSW 2 62257595 missense possibly damaging 0.68
R4998:Slc4a10 UTSW 2 62244439 missense probably benign 0.00
R5069:Slc4a10 UTSW 2 62267571 missense probably benign 0.06
R5223:Slc4a10 UTSW 2 62253366 missense probably damaging 1.00
R5244:Slc4a10 UTSW 2 62288725 missense probably damaging 1.00
R5386:Slc4a10 UTSW 2 62290058 missense probably damaging 1.00
R5808:Slc4a10 UTSW 2 62250472 missense probably damaging 1.00
R5999:Slc4a10 UTSW 2 62243431 missense probably benign 0.10
R6007:Slc4a10 UTSW 2 62268872 missense probably benign 0.44
R6009:Slc4a10 UTSW 2 62046690 missense probably benign 0.00
R6015:Slc4a10 UTSW 2 62228702 missense probably benign 0.05
R6103:Slc4a10 UTSW 2 62234465 missense probably damaging 1.00
R6141:Slc4a10 UTSW 2 62211445 missense probably damaging 1.00
R6193:Slc4a10 UTSW 2 62243357 splice site probably null
R6217:Slc4a10 UTSW 2 62303951 missense probably benign 0.27
R6280:Slc4a10 UTSW 2 62281966 missense probably benign 0.05
R6523:Slc4a10 UTSW 2 62286961 nonsense probably null
R6643:Slc4a10 UTSW 2 62228710 missense possibly damaging 0.96
R6660:Slc4a10 UTSW 2 62250403 missense possibly damaging 0.55
R7008:Slc4a10 UTSW 2 62286922 missense probably benign 0.00
R7083:Slc4a10 UTSW 2 62234495 missense probably benign 0.03
R7223:Slc4a10 UTSW 2 62268665 missense probably damaging 0.99
R7243:Slc4a10 UTSW 2 62303862 missense probably damaging 1.00
R7449:Slc4a10 UTSW 2 62303946 missense probably benign
R7621:Slc4a10 UTSW 2 62250479 missense probably damaging 0.98
R7692:Slc4a10 UTSW 2 62303964 missense possibly damaging 0.94
R7742:Slc4a10 UTSW 2 62296850 missense probably damaging 1.00
R7905:Slc4a10 UTSW 2 62268151 missense probably damaging 1.00
R8179:Slc4a10 UTSW 2 62243448 missense possibly damaging 0.64
R8528:Slc4a10 UTSW 2 62296796 missense possibly damaging 0.79
R8531:Slc4a10 UTSW 2 62267507 missense probably damaging 1.00
R8772:Slc4a10 UTSW 2 62303940 missense probably damaging 1.00
U24488:Slc4a10 UTSW 2 62046658 missense probably benign 0.05
X0019:Slc4a10 UTSW 2 62228599 missense probably damaging 1.00
Z1088:Slc4a10 UTSW 2 62228571 missense probably damaging 1.00
Z1176:Slc4a10 UTSW 2 62211379 missense probably damaging 1.00
Z1176:Slc4a10 UTSW 2 62244416 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCTTAAGTTCTCTGTGGGAGCC -3'
(R):5'- CTAGCTTGCCAGTTCTCTCAGAACC -3'

Sequencing Primer
(F):5'- CATGGGTGAGCAGTCTAGGTG -3'
(R):5'- CAGTTCATGTCATTCCATCAGTAAC -3'
Posted On2013-06-11