Mutagenetix > Incidental Mutation

Incidental Mutation 'R0511:Itga10'

46879

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

038705-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R0511 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96658174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1038 (N1038S)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365]

AlphaFold

E9Q6R1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029744
AA Change: N1039S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: N1039S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119365
AA Change: N1038S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: N1038S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127607

Meta Mutation Damage Score

0.2650

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (116/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,254,071		probably null	Het
A630095E13Rik	A	T	9: 36,638,577		probably null	Het
Abca13	G	T	11: 9,294,559	V2141L	probably benign	Het
Adam17	T	C	12: 21,340,458		probably benign	Het
Adam3	A	T	8: 24,695,315	C456S	probably damaging	Het
AI464131	A	G	4: 41,498,538	F364S	probably damaging	Het
Aldh4a1	G	T	4: 139,642,571		probably benign	Het
Anapc4	A	G	5: 52,842,017		probably benign	Het
Ank3	A	T	10: 69,882,368	Q483L	probably damaging	Het
Ankle2	A	G	5: 110,242,059		probably benign	Het
Ankrd13b	T	A	11: 77,473,288	T150S	possibly damaging	Het
Apeh	A	G	9: 108,087,055	M524T	probably benign	Het
Arl14epl	T	A	18: 46,926,417		probably null	Het
Atg2a	T	C	19: 6,252,539	F964S	possibly damaging	Het
Atg2b	C	T	12: 105,617,153	V2050M	probably damaging	Het
Atp2b4	A	T	1: 133,732,218		probably benign	Het
Bbof1	T	A	12: 84,430,271	S512T	probably benign	Het
BC055324	T	C	1: 163,971,843		probably null	Het
C130079G13Rik	A	G	3: 59,936,350	H155R	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Car10	T	C	11: 93,490,582	Y100H	probably damaging	Het
Ccdc81	T	A	7: 89,893,296	E124V	probably damaging	Het
Cd84	A	G	1: 171,872,927	T204A	probably benign	Het
Celf2	A	G	2: 6,604,176	S178P	probably damaging	Het
Chat	G	A	14: 32,409,019	T555M	probably damaging	Het
Chd6	A	G	2: 160,992,191	F917S	probably damaging	Het
Chrna2	C	A	14: 66,149,104	T233N	probably damaging	Het
Cnpy2	T	C	10: 128,326,185	V109A	probably benign	Het
Col4a1	T	C	8: 11,208,333		probably null	Het
Csmd1	C	T	8: 15,932,529	V2713M	possibly damaging	Het
Cuedc1	G	A	11: 88,183,405	R255Q	probably damaging	Het
Cxcl15	A	T	5: 90,798,038		probably benign	Het
Dach1	A	T	14: 97,901,329	H559Q	possibly damaging	Het
Dennd4c	C	T	4: 86,826,022	T1367M	probably damaging	Het
Depdc5	T	A	5: 32,945,028	Y365*	probably null	Het
Dicer1	T	C	12: 104,702,841	Y1194C	possibly damaging	Het
Dmxl1	C	G	18: 49,891,467	S1736*	probably null	Het
Dnah7a	C	T	1: 53,497,126	R2586K	probably benign	Het
Dnajb8	T	C	6: 88,222,485	M1T	probably null	Het
Dync2h1	G	A	9: 7,122,692	P2088L	probably benign	Het
Eftud2	T	G	11: 102,844,222	H617P	probably damaging	Het
Ephb1	A	G	9: 101,995,980		probably benign	Het
Fam184a	G	T	10: 53,698,879	H155Q	probably benign	Het
Ganc	G	T	2: 120,448,401	E700*	probably null	Het
Gm10912	A	G	2: 104,066,945		probably benign	Het
Gm9047	G	T	6: 29,478,170		probably benign	Het
Haus5	A	T	7: 30,659,067	I294N	probably damaging	Het
Hmgcr	G	T	13: 96,660,143		probably null	Het
Hr	T	A	14: 70,561,912	C641*	probably null	Het
Itgb1bp1	T	G	12: 21,271,435	Y172S	probably damaging	Het
Kprp	T	C	3: 92,824,723	N340S	probably damaging	Het
Kremen1	A	G	11: 5,215,447	I41T	probably damaging	Het
Krt6b	A	G	15: 101,677,607		probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Ldhd	A	G	8: 111,629,677	Y86H	probably benign	Het
Lilra6	A	T	7: 3,912,785	I76N	possibly damaging	Het
Mak	T	C	13: 41,046,267	T299A	probably benign	Het
Med25	A	G	7: 44,885,078		probably null	Het
Mpg	A	T	11: 32,230,039	N189I	probably damaging	Het
Mroh8	A	G	2: 157,229,918	Y556H	probably damaging	Het
Myh8	T	A	11: 67,284,507	S294T	probably benign	Het
Myom1	T	A	17: 71,084,317	D842E	probably benign	Het
Nat2	C	T	8: 67,501,330	Q31*	probably null	Het
Nf1	T	A	11: 79,438,769	M653K	probably benign	Het
Nhs	C	A	X: 161,837,359	R1467I	probably damaging	Het
Npr2	A	G	4: 43,632,801	E206G	probably benign	Het
Nsd3	G	A	8: 25,678,716	G629D	possibly damaging	Het
Nwd1	G	A	8: 72,682,005	C831Y	probably damaging	Het
Olfr1094	A	G	2: 86,829,606	I285V	probably benign	Het
Olfr584	T	C	7: 103,085,851	I111T	probably damaging	Het
P2ry14	A	G	3: 59,116,028	S4P	possibly damaging	Het
Parp4	A	G	14: 56,635,715		probably benign	Het
Pclo	A	G	5: 14,678,285		probably benign	Het
Pclo	T	C	5: 14,679,398		probably benign	Het
Pcnt	A	T	10: 76,404,595	S1202T	possibly damaging	Het
Pfkfb4	A	G	9: 109,027,757	Y412C	probably damaging	Het
Pgm1	T	A	5: 64,110,555	V449D	probably damaging	Het
Poldip3	T	A	15: 83,138,235	D116V	probably damaging	Het
Pom121	G	T	5: 135,381,832	Q824K	unknown	Het
Prkdc	G	T	16: 15,831,282	G3707*	probably null	Het
Prr14l	T	C	5: 32,844,216		probably benign	Het
Ptbp2	T	G	3: 119,720,964	I405L	probably benign	Het
Rad21l	A	T	2: 151,649,069		probably benign	Het
Rbm6	G	A	9: 107,847,289	Q488*	probably null	Het
Rdh1	T	A	10: 127,764,783	M225K	probably benign	Het
Recql5	T	C	11: 115,928,383	D119G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo1	T	C	16: 73,013,125		probably null	Het
Samd12	G	A	15: 53,860,171	T42I	probably benign	Het
Scn10a	A	T	9: 119,613,700	M1494K	probably damaging	Het
Sec31a	G	A	5: 100,375,240	P864L	probably benign	Het
Senp2	T	C	16: 22,036,570	V344A	probably benign	Het
Serpina5	G	A	12: 104,103,362	D278N	probably benign	Het
Sh3tc1	A	T	5: 35,703,462	V1017D	probably damaging	Het
Sin3a	T	A	9: 57,096,895	Y310*	probably null	Het
Slc25a32	T	C	15: 39,097,545	T248A	probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	G	A	2: 62,286,862	V722M	probably damaging	Het
Slco1a4	A	G	6: 141,830,860		probably benign	Het
Smg6	T	A	11: 74,929,058	Y52N	probably damaging	Het
Sncb	T	G	13: 54,765,587	T33P	probably damaging	Het
Spef2	A	G	15: 9,583,984		probably null	Het
Sugp1	A	G	8: 70,059,363	E203G	probably damaging	Het
Suv39h2	A	T	2: 3,472,579	C105S	probably damaging	Het
Tlr1	A	T	5: 64,926,620	F205I	probably damaging	Het
Tnip1	A	T	11: 54,917,873	M496K	probably damaging	Het
Tnxb	G	A	17: 34,718,245	E2889K	probably damaging	Het
Trim30b	T	A	7: 104,365,803	H126L	possibly damaging	Het
Trpm7	A	T	2: 126,826,718	Y759*	probably null	Het
Ttc17	A	G	2: 94,323,120	I1000T	possibly damaging	Het
Ttc27	A	T	17: 74,718,715	N61I	probably benign	Het
Uba6	T	C	5: 86,112,750	Y990C	probably damaging	Het
Vav3	A	G	3: 109,664,440		probably benign	Het
Vmn2r55	C	T	7: 12,671,018	A153T	possibly damaging	Het
Wars2	A	G	3: 99,216,549	D242G	probably damaging	Het
Xylt2	G	A	11: 94,669,936	Q259*	probably null	Het
Zfp27	G	A	7: 29,894,522	P673S	probably damaging	Het
Zgrf1	T	C	3: 127,584,660	I1023T	possibly damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTTCTCTAGGCAAGCTGCACGG -3'
(R):5'- TGAGTTTATGTGCCTCCAGAGCCC -3'

Sequencing Primer
(F):5'- TGCAGAACCTGACTGAGC -3'
(R):5'- CCCGGTTAGTGTTTCAGAGAGAAG -3'

Posted On

2013-06-11