Incidental Mutation 'R0511:Vav3'
ID46881
Institutional Source Beutler Lab
Gene Symbol Vav3
Ensembl Gene ENSMUSG00000033721
Gene Namevav 3 oncogene
SynonymsIdd18.1, A530094I06Rik
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location109340653-109685698 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 109664440 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046864] [ENSMUST00000106576]
Predicted Effect probably benign
Transcript: ENSMUST00000046864
SMART Domains Protein: ENSMUSP00000036270
Gene: ENSMUSG00000033721

DomainStartEndE-ValueType
CH 3 115 2.1e-18 SMART
low complexity region 160 175 N/A INTRINSIC
RhoGEF 196 370 5.09e-56 SMART
PH 401 504 1.88e-9 SMART
C1 514 562 2.17e-11 SMART
SH3 595 659 6.4e-6 SMART
SH2 670 752 2.59e-26 SMART
SH3 791 847 8.96e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106576
SMART Domains Protein: ENSMUSP00000102186
Gene: ENSMUSG00000033721

DomainStartEndE-ValueType
SH3 35 99 3.8e-8 SMART
SH2 110 192 1.6e-28 SMART
SH3 233 289 5.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148866
SMART Domains Protein: ENSMUSP00000121660
Gene: ENSMUSG00000033721

DomainStartEndE-ValueType
SH2 33 115 2.59e-26 SMART
PDB:2KBT|A 149 179 6e-6 PDB
Blast:SH3 154 179 2e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in tachycardia, systemic arterial hypertension, cardiovascular remodeling, hyperactivity of sympathetic neurons and thus high catecholamine levels, and increased levels of kidney-related hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Vav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Vav3 APN 3 109528392 splice site probably benign
IGL01488:Vav3 APN 3 109657944 missense probably damaging 0.99
IGL01649:Vav3 APN 3 109562762 missense probably benign
IGL01675:Vav3 APN 3 109664413 missense probably benign 0.16
IGL02189:Vav3 APN 3 109525960 splice site probably benign
IGL03134:Vav3 APN 3 109563094 splice site probably benign
IGL03358:Vav3 APN 3 109647673 missense probably damaging 1.00
PIT4131001:Vav3 UTSW 3 109664435 critical splice donor site probably null
R0542:Vav3 UTSW 3 109527430 missense probably damaging 1.00
R0630:Vav3 UTSW 3 109424012 missense probably damaging 1.00
R0683:Vav3 UTSW 3 109651813 missense probably benign 0.04
R0833:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0836:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0940:Vav3 UTSW 3 109562835 missense possibly damaging 0.78
R1561:Vav3 UTSW 3 109494838 critical splice donor site probably null
R1617:Vav3 UTSW 3 109510978 missense probably damaging 1.00
R1760:Vav3 UTSW 3 109341127 missense possibly damaging 0.61
R1834:Vav3 UTSW 3 109506426 missense probably benign 0.06
R1928:Vav3 UTSW 3 109506422 missense possibly damaging 0.94
R2090:Vav3 UTSW 3 109647739 critical splice donor site probably null
R2190:Vav3 UTSW 3 109562814 missense probably damaging 1.00
R2483:Vav3 UTSW 3 109341166 missense probably damaging 1.00
R3124:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3125:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3800:Vav3 UTSW 3 109628039 missense probably benign 0.45
R3919:Vav3 UTSW 3 109527538 missense possibly damaging 0.51
R4693:Vav3 UTSW 3 109563218 splice site probably benign
R4779:Vav3 UTSW 3 109508794 missense possibly damaging 0.88
R5384:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5385:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5474:Vav3 UTSW 3 109664421 missense probably benign
R5703:Vav3 UTSW 3 109341241 missense probably benign 0.13
R5997:Vav3 UTSW 3 109501461 missense probably damaging 1.00
R6109:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6110:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6120:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6123:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6124:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6186:Vav3 UTSW 3 109516067 missense probably damaging 1.00
R6291:Vav3 UTSW 3 109508854 missense possibly damaging 0.82
R6335:Vav3 UTSW 3 109563196 missense probably benign 0.01
R6647:Vav3 UTSW 3 109527416 missense probably benign 0.19
R6849:Vav3 UTSW 3 109521466 missense probably damaging 1.00
R6897:Vav3 UTSW 3 109527494 missense probably damaging 1.00
R7075:Vav3 UTSW 3 109525924 missense possibly damaging 0.47
R7131:Vav3 UTSW 3 109664346 missense probably damaging 1.00
R7328:Vav3 UTSW 3 109503428 missense probably benign 0.10
R7365:Vav3 UTSW 3 109628099 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCAGGTACAACCAGACAGTAGGCAG -3'
(R):5'- GCCCTAGAATACTAGGTACACTGGCAG -3'

Sequencing Primer
(F):5'- AGGCTTAAAATGAGTATCCTTGTATC -3'
(R):5'- GGCCATATTTCAAACTTCAGAATG -3'
Posted On2013-06-11