Incidental Mutation 'R0511:Dennd4c'
ID46886
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86826022 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1367 (T1367M)
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably damaging
Transcript: ENSMUST00000045512
AA Change: T1416M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: T1416M

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082026
AA Change: T1416M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: T1416M

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142837
AA Change: T1367M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: T1367M

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
Predicted Primers PCR Primer
(F):5'- TCCTTACCGCGCTTACAAAGACC -3'
(R):5'- CCCCAGCAGAGAAAGTGAAATGTCA -3'

Sequencing Primer
(F):5'- CGGTCCACTTCCTTATCAGC -3'
(R):5'- agagcagccatcttaaccac -3'
Posted On2013-06-11