Incidental Mutation 'R0511:Aldh4a1'
ID 46887
Institutional Source Beutler Lab
Gene Symbol Aldh4a1
Ensembl Gene ENSMUSG00000028737
Gene Name aldehyde dehydrogenase 4 family, member A1
Synonyms P5CDH, Ahd-1, A930035F14Rik, ALDH4, Ssdh1, Ahd1
MMRRC Submission 038705-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R0511 (G1)
Quality Score 213
Status Validated
Chromosome 4
Chromosomal Location 139350177-139377001 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 139369882 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039818] [ENSMUST00000178644]
AlphaFold Q8CHT0
Predicted Effect probably benign
Transcript: ENSMUST00000039818
SMART Domains Protein: ENSMUSP00000043821
Gene: ENSMUSG00000028737

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Aldedh 73 546 7.6e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146309
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183787
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A G 3: 59,843,771 (GRCm39) H155R possibly damaging Het
Abca13 G T 11: 9,244,559 (GRCm39) V2141L probably benign Het
Adam17 T C 12: 21,390,459 (GRCm39) probably benign Het
Adam3 A T 8: 25,185,331 (GRCm39) C456S probably damaging Het
Anapc4 A G 5: 52,999,359 (GRCm39) probably benign Het
Ank3 A T 10: 69,718,198 (GRCm39) Q483L probably damaging Het
Ankle2 A G 5: 110,389,925 (GRCm39) probably benign Het
Ankrd13b T A 11: 77,364,114 (GRCm39) T150S possibly damaging Het
Apeh A G 9: 107,964,254 (GRCm39) M524T probably benign Het
Arl14epl T A 18: 47,059,484 (GRCm39) probably null Het
Atg2a T C 19: 6,302,569 (GRCm39) F964S possibly damaging Het
Atg2b C T 12: 105,583,412 (GRCm39) V2050M probably damaging Het
Atp2b4 A T 1: 133,659,956 (GRCm39) probably benign Het
Bbof1 T A 12: 84,477,045 (GRCm39) S512T probably benign Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Car10 T C 11: 93,381,408 (GRCm39) Y100H probably damaging Het
Ccdc81 T A 7: 89,542,504 (GRCm39) E124V probably damaging Het
Cd84 A G 1: 171,700,494 (GRCm39) T204A probably benign Het
Celf2 A G 2: 6,608,987 (GRCm39) S178P probably damaging Het
Chat G A 14: 32,130,976 (GRCm39) T555M probably damaging Het
Chd6 A G 2: 160,834,111 (GRCm39) F917S probably damaging Het
Chrna2 C A 14: 66,386,553 (GRCm39) T233N probably damaging Het
Cnpy2 T C 10: 128,162,054 (GRCm39) V109A probably benign Het
Col4a1 T C 8: 11,258,333 (GRCm39) probably null Het
Csmd1 C T 8: 15,982,529 (GRCm39) V2713M possibly damaging Het
Cuedc1 G A 11: 88,074,231 (GRCm39) R255Q probably damaging Het
Cxcl15 A T 5: 90,945,897 (GRCm39) probably benign Het
Dach1 A T 14: 98,138,765 (GRCm39) H559Q possibly damaging Het
Dele1 T C 18: 38,387,124 (GRCm39) probably null Het
Dennd4c C T 4: 86,744,259 (GRCm39) T1367M probably damaging Het
Depdc5 T A 5: 33,102,372 (GRCm39) Y365* probably null Het
Dicer1 T C 12: 104,669,100 (GRCm39) Y1194C possibly damaging Het
Dmxl1 C G 18: 50,024,534 (GRCm39) S1736* probably null Het
Dnah7a C T 1: 53,536,285 (GRCm39) R2586K probably benign Het
Dnajb8 T C 6: 88,199,467 (GRCm39) M1T probably null Het
Dync2h1 G A 9: 7,122,692 (GRCm39) P2088L probably benign Het
Eftud2 T G 11: 102,735,048 (GRCm39) H617P probably damaging Het
Ephb1 A G 9: 101,873,179 (GRCm39) probably benign Het
Fam184a G T 10: 53,574,975 (GRCm39) H155Q probably benign Het
Firrm T C 1: 163,799,412 (GRCm39) probably null Het
Ganc G T 2: 120,278,882 (GRCm39) E700* probably null Het
Gm10912 A G 2: 103,897,290 (GRCm39) probably benign Het
Haus5 A T 7: 30,358,492 (GRCm39) I294N probably damaging Het
Hmgcr G T 13: 96,796,651 (GRCm39) probably null Het
Hr T A 14: 70,799,352 (GRCm39) C641* probably null Het
Itga10 A G 3: 96,565,490 (GRCm39) N1038S probably damaging Het
Itgb1bp1 T G 12: 21,321,436 (GRCm39) Y172S probably damaging Het
Kprp T C 3: 92,732,030 (GRCm39) N340S probably damaging Het
Kremen1 A G 11: 5,165,447 (GRCm39) I41T probably damaging Het
Krt6b A G 15: 101,586,042 (GRCm39) probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Ldhd A G 8: 112,356,309 (GRCm39) Y86H probably benign Het
Lilra6 A T 7: 3,915,784 (GRCm39) I76N possibly damaging Het
Mak T C 13: 41,199,743 (GRCm39) T299A probably benign Het
Med25 A G 7: 44,534,502 (GRCm39) probably null Het
Mpg A T 11: 32,180,039 (GRCm39) N189I probably damaging Het
Mroh8 A G 2: 157,071,838 (GRCm39) Y556H probably damaging Het
Myh8 T A 11: 67,175,333 (GRCm39) S294T probably benign Het
Myom1 T A 17: 71,391,312 (GRCm39) D842E probably benign Het
Myorg A G 4: 41,498,538 (GRCm39) F364S probably damaging Het
Nat2 C T 8: 67,953,982 (GRCm39) Q31* probably null Het
Nf1 T A 11: 79,329,595 (GRCm39) M653K probably benign Het
Nhs C A X: 160,620,355 (GRCm39) R1467I probably damaging Het
Npr2 A G 4: 43,632,801 (GRCm39) E206G probably benign Het
Nsd3 G A 8: 26,168,732 (GRCm39) G629D possibly damaging Het
Nwd1 G A 8: 73,408,633 (GRCm39) C831Y probably damaging Het
Or52r1c T C 7: 102,735,058 (GRCm39) I111T probably damaging Het
Or5t9 A G 2: 86,659,950 (GRCm39) I285V probably benign Het
P2ry14 A G 3: 59,023,449 (GRCm39) S4P possibly damaging Het
Parp4 A G 14: 56,873,172 (GRCm39) probably benign Het
Pate14 A T 9: 36,549,873 (GRCm39) probably null Het
Pclo A G 5: 14,728,299 (GRCm39) probably benign Het
Pclo T C 5: 14,729,412 (GRCm39) probably benign Het
Pcnt A T 10: 76,240,429 (GRCm39) S1202T possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pgm2 T A 5: 64,267,898 (GRCm39) V449D probably damaging Het
Poldip3 T A 15: 83,022,436 (GRCm39) D116V probably damaging Het
Pom121 G T 5: 135,410,686 (GRCm39) Q824K unknown Het
Prkdc G T 16: 15,649,146 (GRCm39) G3707* probably null Het
Prr14l T C 5: 33,001,560 (GRCm39) probably benign Het
Ptbp2 T G 3: 119,514,613 (GRCm39) I405L probably benign Het
Rad21l A T 2: 151,490,989 (GRCm39) probably benign Het
Rbm6 G A 9: 107,724,488 (GRCm39) Q488* probably null Het
Rdh1 T A 10: 127,600,652 (GRCm39) M225K probably benign Het
Recql5 T C 11: 115,819,209 (GRCm39) D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo1 T C 16: 72,810,013 (GRCm39) probably null Het
Samd12 G A 15: 53,723,567 (GRCm39) T42I probably benign Het
Scn10a A T 9: 119,442,766 (GRCm39) M1494K probably damaging Het
Sec31a G A 5: 100,523,099 (GRCm39) P864L probably benign Het
Senp2 T C 16: 21,855,320 (GRCm39) V344A probably benign Het
Serpina5 G A 12: 104,069,621 (GRCm39) D278N probably benign Het
Sh3tc1 A T 5: 35,860,806 (GRCm39) V1017D probably damaging Het
Sin3a T A 9: 57,004,179 (GRCm39) Y310* probably null Het
Slc25a32 T C 15: 38,960,940 (GRCm39) T248A probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 G A 2: 62,117,206 (GRCm39) V722M probably damaging Het
Slco1a4 A G 6: 141,776,586 (GRCm39) probably benign Het
Smg6 T A 11: 74,819,884 (GRCm39) Y52N probably damaging Het
Sncb T G 13: 54,913,400 (GRCm39) T33P probably damaging Het
Spef2 A G 15: 9,584,070 (GRCm39) probably null Het
Spmip1 G T 6: 29,478,169 (GRCm39) probably benign Het
Sugp1 A G 8: 70,512,013 (GRCm39) E203G probably damaging Het
Suv39h2 A T 2: 3,473,616 (GRCm39) C105S probably damaging Het
Tlr1 A T 5: 65,083,963 (GRCm39) F205I probably damaging Het
Tnip1 A T 11: 54,808,699 (GRCm39) M496K probably damaging Het
Tnxb G A 17: 34,937,219 (GRCm39) E2889K probably damaging Het
Trim30b T A 7: 104,015,010 (GRCm39) H126L possibly damaging Het
Trpm7 A T 2: 126,668,638 (GRCm39) Y759* probably null Het
Ttc17 A G 2: 94,153,465 (GRCm39) I1000T possibly damaging Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Uba6 T C 5: 86,260,609 (GRCm39) Y990C probably damaging Het
Vav3 A G 3: 109,571,756 (GRCm39) probably benign Het
Vmn2r55 C T 7: 12,404,945 (GRCm39) A153T possibly damaging Het
Wars2 A G 3: 99,123,865 (GRCm39) D242G probably damaging Het
Xylt2 G A 11: 94,560,762 (GRCm39) Q259* probably null Het
Zfp27 G A 7: 29,593,947 (GRCm39) P673S probably damaging Het
Zgrf1 T C 3: 127,378,309 (GRCm39) I1023T possibly damaging Het
Other mutations in Aldh4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Aldh4a1 APN 4 139,369,471 (GRCm39) nonsense probably null
IGL01916:Aldh4a1 APN 4 139,371,457 (GRCm39) missense probably damaging 1.00
IGL02368:Aldh4a1 APN 4 139,375,511 (GRCm39) nonsense probably null
IGL02469:Aldh4a1 APN 4 139,375,472 (GRCm39) missense probably damaging 0.98
PIT4402001:Aldh4a1 UTSW 4 139,369,502 (GRCm39) nonsense probably null
R1352:Aldh4a1 UTSW 4 139,362,830 (GRCm39) missense probably benign 0.18
R1484:Aldh4a1 UTSW 4 139,370,758 (GRCm39) missense probably benign 0.00
R1717:Aldh4a1 UTSW 4 139,361,305 (GRCm39) splice site probably null
R1717:Aldh4a1 UTSW 4 139,365,840 (GRCm39) missense possibly damaging 0.93
R1729:Aldh4a1 UTSW 4 139,371,472 (GRCm39) missense probably damaging 1.00
R1784:Aldh4a1 UTSW 4 139,371,472 (GRCm39) missense probably damaging 1.00
R1785:Aldh4a1 UTSW 4 139,371,439 (GRCm39) missense probably benign 0.01
R1786:Aldh4a1 UTSW 4 139,371,439 (GRCm39) missense probably benign 0.01
R3696:Aldh4a1 UTSW 4 139,369,562 (GRCm39) missense possibly damaging 0.68
R3697:Aldh4a1 UTSW 4 139,369,562 (GRCm39) missense possibly damaging 0.68
R3698:Aldh4a1 UTSW 4 139,369,562 (GRCm39) missense possibly damaging 0.68
R4603:Aldh4a1 UTSW 4 139,370,740 (GRCm39) missense probably damaging 0.97
R5197:Aldh4a1 UTSW 4 139,375,612 (GRCm39) intron probably benign
R5375:Aldh4a1 UTSW 4 139,361,233 (GRCm39) missense probably benign
R5539:Aldh4a1 UTSW 4 139,365,833 (GRCm39) missense probably benign 0.05
R5590:Aldh4a1 UTSW 4 139,369,415 (GRCm39) missense probably damaging 1.00
R6101:Aldh4a1 UTSW 4 139,365,806 (GRCm39) missense possibly damaging 0.91
R6105:Aldh4a1 UTSW 4 139,365,806 (GRCm39) missense possibly damaging 0.91
R7600:Aldh4a1 UTSW 4 139,372,315 (GRCm39) missense probably benign
R7666:Aldh4a1 UTSW 4 139,361,268 (GRCm39) missense probably damaging 0.99
R8356:Aldh4a1 UTSW 4 139,365,833 (GRCm39) missense probably benign 0.05
R8832:Aldh4a1 UTSW 4 139,371,466 (GRCm39) missense probably benign
R9047:Aldh4a1 UTSW 4 139,350,511 (GRCm39) splice site probably benign
R9407:Aldh4a1 UTSW 4 139,372,345 (GRCm39) missense probably benign 0.01
R9638:Aldh4a1 UTSW 4 139,371,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAATTTGAGTGCCTCCCTGC -3'
(R):5'- TGCACACTTTAGGGGCTTGCTG -3'

Sequencing Primer
(F):5'- TCTGAGGCTGGGTCCTTCC -3'
(R):5'- CTTGCTGAGTCTGGTCTGAG -3'
Posted On 2013-06-11