Incidental Mutation 'R0511:Prr14l'
ID46891
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Nameproline rich 14-like
Synonyms
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0511 (G1)
Quality Score221
Status Validated
Chromosome5
Chromosomal Location32789820-32854256 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 32844216 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000130134]
Predicted Effect unknown
Transcript: ENSMUST00000120129
AA Change: D100G
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: D100G

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130134
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTAAGCCATATGCTACCCGTCCAC -3'
(R):5'- CAGATGTAAAGCCTGGAGCCTCAC -3'

Sequencing Primer
(F):5'- ACATTAGAGGCATTGCTCTGC -3'
(R):5'- TGGAGCCTCACGCTCTC -3'
Posted On2013-06-11