Incidental Mutation 'R0511:Lilra6'
ID 46905
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Name leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Synonyms 7M1, Pira3
MMRRC Submission 038705-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R0511 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 3911279-3918502 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3915784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 76 (I76N)
Ref Sequence ENSEMBL: ENSMUSP00000145890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
AlphaFold A0A0B4J1F3
Predicted Effect probably benign
Transcript: ENSMUST00000038176
AA Change: I317N

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: I317N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090689
AA Change: I279N

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: I279N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131255
Predicted Effect possibly damaging
Transcript: ENSMUST00000206077
AA Change: I76N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206851
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A G 3: 59,843,771 (GRCm39) H155R possibly damaging Het
Abca13 G T 11: 9,244,559 (GRCm39) V2141L probably benign Het
Adam17 T C 12: 21,390,459 (GRCm39) probably benign Het
Adam3 A T 8: 25,185,331 (GRCm39) C456S probably damaging Het
Aldh4a1 G T 4: 139,369,882 (GRCm39) probably benign Het
Anapc4 A G 5: 52,999,359 (GRCm39) probably benign Het
Ank3 A T 10: 69,718,198 (GRCm39) Q483L probably damaging Het
Ankle2 A G 5: 110,389,925 (GRCm39) probably benign Het
Ankrd13b T A 11: 77,364,114 (GRCm39) T150S possibly damaging Het
Apeh A G 9: 107,964,254 (GRCm39) M524T probably benign Het
Arl14epl T A 18: 47,059,484 (GRCm39) probably null Het
Atg2a T C 19: 6,302,569 (GRCm39) F964S possibly damaging Het
Atg2b C T 12: 105,583,412 (GRCm39) V2050M probably damaging Het
Atp2b4 A T 1: 133,659,956 (GRCm39) probably benign Het
Bbof1 T A 12: 84,477,045 (GRCm39) S512T probably benign Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Car10 T C 11: 93,381,408 (GRCm39) Y100H probably damaging Het
Ccdc81 T A 7: 89,542,504 (GRCm39) E124V probably damaging Het
Cd84 A G 1: 171,700,494 (GRCm39) T204A probably benign Het
Celf2 A G 2: 6,608,987 (GRCm39) S178P probably damaging Het
Chat G A 14: 32,130,976 (GRCm39) T555M probably damaging Het
Chd6 A G 2: 160,834,111 (GRCm39) F917S probably damaging Het
Chrna2 C A 14: 66,386,553 (GRCm39) T233N probably damaging Het
Cnpy2 T C 10: 128,162,054 (GRCm39) V109A probably benign Het
Col4a1 T C 8: 11,258,333 (GRCm39) probably null Het
Csmd1 C T 8: 15,982,529 (GRCm39) V2713M possibly damaging Het
Cuedc1 G A 11: 88,074,231 (GRCm39) R255Q probably damaging Het
Cxcl15 A T 5: 90,945,897 (GRCm39) probably benign Het
Dach1 A T 14: 98,138,765 (GRCm39) H559Q possibly damaging Het
Dele1 T C 18: 38,387,124 (GRCm39) probably null Het
Dennd4c C T 4: 86,744,259 (GRCm39) T1367M probably damaging Het
Depdc5 T A 5: 33,102,372 (GRCm39) Y365* probably null Het
Dicer1 T C 12: 104,669,100 (GRCm39) Y1194C possibly damaging Het
Dmxl1 C G 18: 50,024,534 (GRCm39) S1736* probably null Het
Dnah7a C T 1: 53,536,285 (GRCm39) R2586K probably benign Het
Dnajb8 T C 6: 88,199,467 (GRCm39) M1T probably null Het
Dync2h1 G A 9: 7,122,692 (GRCm39) P2088L probably benign Het
Eftud2 T G 11: 102,735,048 (GRCm39) H617P probably damaging Het
Ephb1 A G 9: 101,873,179 (GRCm39) probably benign Het
Fam184a G T 10: 53,574,975 (GRCm39) H155Q probably benign Het
Firrm T C 1: 163,799,412 (GRCm39) probably null Het
Ganc G T 2: 120,278,882 (GRCm39) E700* probably null Het
Gm10912 A G 2: 103,897,290 (GRCm39) probably benign Het
Haus5 A T 7: 30,358,492 (GRCm39) I294N probably damaging Het
Hmgcr G T 13: 96,796,651 (GRCm39) probably null Het
Hr T A 14: 70,799,352 (GRCm39) C641* probably null Het
Itga10 A G 3: 96,565,490 (GRCm39) N1038S probably damaging Het
Itgb1bp1 T G 12: 21,321,436 (GRCm39) Y172S probably damaging Het
Kprp T C 3: 92,732,030 (GRCm39) N340S probably damaging Het
Kremen1 A G 11: 5,165,447 (GRCm39) I41T probably damaging Het
Krt6b A G 15: 101,586,042 (GRCm39) probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Ldhd A G 8: 112,356,309 (GRCm39) Y86H probably benign Het
Mak T C 13: 41,199,743 (GRCm39) T299A probably benign Het
Med25 A G 7: 44,534,502 (GRCm39) probably null Het
Mpg A T 11: 32,180,039 (GRCm39) N189I probably damaging Het
Mroh8 A G 2: 157,071,838 (GRCm39) Y556H probably damaging Het
Myh8 T A 11: 67,175,333 (GRCm39) S294T probably benign Het
Myom1 T A 17: 71,391,312 (GRCm39) D842E probably benign Het
Myorg A G 4: 41,498,538 (GRCm39) F364S probably damaging Het
Nat2 C T 8: 67,953,982 (GRCm39) Q31* probably null Het
Nf1 T A 11: 79,329,595 (GRCm39) M653K probably benign Het
Nhs C A X: 160,620,355 (GRCm39) R1467I probably damaging Het
Npr2 A G 4: 43,632,801 (GRCm39) E206G probably benign Het
Nsd3 G A 8: 26,168,732 (GRCm39) G629D possibly damaging Het
Nwd1 G A 8: 73,408,633 (GRCm39) C831Y probably damaging Het
Or52r1c T C 7: 102,735,058 (GRCm39) I111T probably damaging Het
Or5t9 A G 2: 86,659,950 (GRCm39) I285V probably benign Het
P2ry14 A G 3: 59,023,449 (GRCm39) S4P possibly damaging Het
Parp4 A G 14: 56,873,172 (GRCm39) probably benign Het
Pate14 A T 9: 36,549,873 (GRCm39) probably null Het
Pclo A G 5: 14,728,299 (GRCm39) probably benign Het
Pclo T C 5: 14,729,412 (GRCm39) probably benign Het
Pcnt A T 10: 76,240,429 (GRCm39) S1202T possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pgm2 T A 5: 64,267,898 (GRCm39) V449D probably damaging Het
Poldip3 T A 15: 83,022,436 (GRCm39) D116V probably damaging Het
Pom121 G T 5: 135,410,686 (GRCm39) Q824K unknown Het
Prkdc G T 16: 15,649,146 (GRCm39) G3707* probably null Het
Prr14l T C 5: 33,001,560 (GRCm39) probably benign Het
Ptbp2 T G 3: 119,514,613 (GRCm39) I405L probably benign Het
Rad21l A T 2: 151,490,989 (GRCm39) probably benign Het
Rbm6 G A 9: 107,724,488 (GRCm39) Q488* probably null Het
Rdh1 T A 10: 127,600,652 (GRCm39) M225K probably benign Het
Recql5 T C 11: 115,819,209 (GRCm39) D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo1 T C 16: 72,810,013 (GRCm39) probably null Het
Samd12 G A 15: 53,723,567 (GRCm39) T42I probably benign Het
Scn10a A T 9: 119,442,766 (GRCm39) M1494K probably damaging Het
Sec31a G A 5: 100,523,099 (GRCm39) P864L probably benign Het
Senp2 T C 16: 21,855,320 (GRCm39) V344A probably benign Het
Serpina5 G A 12: 104,069,621 (GRCm39) D278N probably benign Het
Sh3tc1 A T 5: 35,860,806 (GRCm39) V1017D probably damaging Het
Sin3a T A 9: 57,004,179 (GRCm39) Y310* probably null Het
Slc25a32 T C 15: 38,960,940 (GRCm39) T248A probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 G A 2: 62,117,206 (GRCm39) V722M probably damaging Het
Slco1a4 A G 6: 141,776,586 (GRCm39) probably benign Het
Smg6 T A 11: 74,819,884 (GRCm39) Y52N probably damaging Het
Sncb T G 13: 54,913,400 (GRCm39) T33P probably damaging Het
Spef2 A G 15: 9,584,070 (GRCm39) probably null Het
Spmip1 G T 6: 29,478,169 (GRCm39) probably benign Het
Sugp1 A G 8: 70,512,013 (GRCm39) E203G probably damaging Het
Suv39h2 A T 2: 3,473,616 (GRCm39) C105S probably damaging Het
Tlr1 A T 5: 65,083,963 (GRCm39) F205I probably damaging Het
Tnip1 A T 11: 54,808,699 (GRCm39) M496K probably damaging Het
Tnxb G A 17: 34,937,219 (GRCm39) E2889K probably damaging Het
Trim30b T A 7: 104,015,010 (GRCm39) H126L possibly damaging Het
Trpm7 A T 2: 126,668,638 (GRCm39) Y759* probably null Het
Ttc17 A G 2: 94,153,465 (GRCm39) I1000T possibly damaging Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Uba6 T C 5: 86,260,609 (GRCm39) Y990C probably damaging Het
Vav3 A G 3: 109,571,756 (GRCm39) probably benign Het
Vmn2r55 C T 7: 12,404,945 (GRCm39) A153T possibly damaging Het
Wars2 A G 3: 99,123,865 (GRCm39) D242G probably damaging Het
Xylt2 G A 11: 94,560,762 (GRCm39) Q259* probably null Het
Zfp27 G A 7: 29,593,947 (GRCm39) P673S probably damaging Het
Zgrf1 T C 3: 127,378,309 (GRCm39) I1023T possibly damaging Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3,914,553 (GRCm39) missense probably benign 0.04
IGL00569:Lilra6 APN 7 3,917,588 (GRCm39) missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3,916,056 (GRCm39) missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3,914,403 (GRCm39) splice site probably benign
IGL01585:Lilra6 APN 7 3,917,498 (GRCm39) missense probably benign 0.01
IGL02195:Lilra6 APN 7 3,917,549 (GRCm39) missense probably benign 0.00
IGL02586:Lilra6 APN 7 3,911,819 (GRCm39) missense probably benign 0.36
IGL02719:Lilra6 APN 7 3,915,991 (GRCm39) missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3,915,626 (GRCm39) missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3,917,647 (GRCm39) splice site probably benign
R0233:Lilra6 UTSW 7 3,917,935 (GRCm39) missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3,917,935 (GRCm39) missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3,917,774 (GRCm39) splice site probably benign
R0483:Lilra6 UTSW 7 3,916,138 (GRCm39) missense probably benign 0.02
R1472:Lilra6 UTSW 7 3,915,718 (GRCm39) missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3,914,407 (GRCm39) critical splice donor site probably null
R1584:Lilra6 UTSW 7 3,915,661 (GRCm39) missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3,918,066 (GRCm39) missense probably benign 0.28
R2411:Lilra6 UTSW 7 3,914,453 (GRCm39) missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3,917,857 (GRCm39) missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3,914,417 (GRCm39) missense probably benign 0.20
R4074:Lilra6 UTSW 7 3,917,889 (GRCm39) missense probably benign 0.23
R4284:Lilra6 UTSW 7 3,911,803 (GRCm39) missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3,915,028 (GRCm39) nonsense probably null
R4894:Lilra6 UTSW 7 3,915,530 (GRCm39) missense probably benign 0.01
R4977:Lilra6 UTSW 7 3,917,382 (GRCm39) missense probably benign 0.01
R5048:Lilra6 UTSW 7 3,918,440 (GRCm39) critical splice donor site probably null
R5164:Lilra6 UTSW 7 3,917,880 (GRCm39) missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3,917,635 (GRCm39) missense probably benign 0.00
R5527:Lilra6 UTSW 7 3,917,586 (GRCm39) start gained probably benign
R6281:Lilra6 UTSW 7 3,914,972 (GRCm39) missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3,915,932 (GRCm39) missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3,917,387 (GRCm39) missense probably benign 0.06
R6565:Lilra6 UTSW 7 3,918,019 (GRCm39) missense probably benign
R7017:Lilra6 UTSW 7 3,911,707 (GRCm39) missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3,916,196 (GRCm39) missense probably damaging 1.00
R7747:Lilra6 UTSW 7 3,915,995 (GRCm39) missense probably benign 0.16
R8056:Lilra6 UTSW 7 3,915,551 (GRCm39) missense probably damaging 1.00
R8280:Lilra6 UTSW 7 3,916,046 (GRCm39) missense probably benign 0.01
R9197:Lilra6 UTSW 7 3,915,716 (GRCm39) missense possibly damaging 0.94
R9354:Lilra6 UTSW 7 3,914,628 (GRCm39) missense probably damaging 1.00
R9379:Lilra6 UTSW 7 3,916,166 (GRCm39) missense probably damaging 1.00
R9406:Lilra6 UTSW 7 3,917,853 (GRCm39) missense probably benign
R9462:Lilra6 UTSW 7 3,914,994 (GRCm39) missense probably damaging 0.97
R9649:Lilra6 UTSW 7 3,917,521 (GRCm39) missense possibly damaging 0.47
Z1176:Lilra6 UTSW 7 3,918,073 (GRCm39) critical splice acceptor site probably null
Z1177:Lilra6 UTSW 7 3,915,580 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGGAGAGCACTAGGTACTGACCAC -3'
(R):5'- GACAACATGCAGGGCAATATCGC -3'

Sequencing Primer
(F):5'- AACATCTGAATGCCCCTGTATG -3'
(R):5'- CAGGGCAATATCGCTGTTATTGTTAC -3'
Posted On 2013-06-11