Incidental Mutation 'R0511:Col4a1'
ID46913
Institutional Source Beutler Lab
Gene Symbol Col4a1
Ensembl Gene ENSMUSG00000031502
Gene Namecollagen, type IV, alpha 1
SynonymsDel(8)Bru44H, Svc, Raw, Del(8)44H, Bru, Col4a-1, alpha1(IV) collagen
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11198423-11312826 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 11208333 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000033898] [ENSMUST00000209735] [ENSMUST00000209735]
Predicted Effect probably null
Transcript: ENSMUST00000033898
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect probably null
Transcript: ENSMUST00000033898
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151014
Predicted Effect probably null
Transcript: ENSMUST00000209598
Predicted Effect probably null
Transcript: ENSMUST00000209598
Predicted Effect probably null
Transcript: ENSMUST00000209598
Predicted Effect probably null
Transcript: ENSMUST00000209598
Predicted Effect probably benign
Transcript: ENSMUST00000209735
Predicted Effect probably benign
Transcript: ENSMUST00000209735
Meta Mutation Damage Score 0.9560 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of two alpha-1 and one alpha-2 subunits that assembles into a type IV collagen network. This gene is located adjacent to the gene encoding alpha-2 subunit. Mice lacking both the alpha-1 and alpha-2 subunits of collagen IV die in utero due to structural deficiencies in the basement membranes and certain mutations in this gene cause perinatal cerebral hemorrhage and porencephaly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice with ENU induced alleles have various eye and vision defects and may show bruising at birth. Mice carrying the G498V mutation have renal glomerular defects that resolve within the first weeks of life, but show retinal tortuosity, muscular dystrophy, brain hemorrhages, and renal cysts as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Col4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col4a1 APN 8 11240077 splice site probably benign
IGL00503:Col4a1 APN 8 11240076 splice site probably benign
IGL00938:Col4a1 APN 8 11236456 intron probably benign
IGL01295:Col4a1 APN 8 11236075 intron probably benign
IGL01406:Col4a1 APN 8 11218898 missense probably damaging 1.00
IGL01807:Col4a1 APN 8 11247056 utr 5 prime probably benign
IGL01865:Col4a1 APN 8 11201790 utr 3 prime probably benign
IGL02166:Col4a1 APN 8 11244509 unclassified probably benign
IGL02234:Col4a1 APN 8 11216713 missense probably damaging 1.00
IGL02445:Col4a1 APN 8 11233911 intron probably benign
IGL02719:Col4a1 APN 8 11231950 intron probably benign
IGL02817:Col4a1 APN 8 11220259 missense probably damaging 1.00
IGL02821:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02870:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02935:Col4a1 APN 8 11219166 missense probably damaging 1.00
IGL03085:Col4a1 APN 8 11222198 nonsense probably null
Wayne UTSW 8 11209650 missense probably damaging 1.00
IGL03134:Col4a1 UTSW 8 11240069 critical splice acceptor site probably null
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0238:Col4a1 UTSW 8 11218780 splice site probably benign
R0239:Col4a1 UTSW 8 11218780 splice site probably benign
R0268:Col4a1 UTSW 8 11267588 splice site probably benign
R0320:Col4a1 UTSW 8 11242782 splice site probably null
R0402:Col4a1 UTSW 8 11199838 utr 3 prime probably benign
R0483:Col4a1 UTSW 8 11236423 splice site probably benign
R0544:Col4a1 UTSW 8 11226487 intron probably benign
R0630:Col4a1 UTSW 8 11199889 splice site probably benign
R0648:Col4a1 UTSW 8 11246892 missense unknown
R0733:Col4a1 UTSW 8 11218934 missense possibly damaging 0.46
R0839:Col4a1 UTSW 8 11221015 missense probably damaging 0.96
R0900:Col4a1 UTSW 8 11218014 small deletion probably benign
R0941:Col4a1 UTSW 8 11208296 missense unknown
R1456:Col4a1 UTSW 8 11242829 splice site probably benign
R1728:Col4a1 UTSW 8 11212712 missense possibly damaging 0.81
R1832:Col4a1 UTSW 8 11214644 splice site probably benign
R1862:Col4a1 UTSW 8 11226439 intron probably benign
R1955:Col4a1 UTSW 8 11208228 splice site probably null
R2058:Col4a1 UTSW 8 11210792 missense probably damaging 0.96
R2263:Col4a1 UTSW 8 11312586 unclassified probably benign
R2696:Col4a1 UTSW 8 11235092 splice site probably null
R3826:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3828:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3829:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3830:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3923:Col4a1 UTSW 8 11201665 utr 3 prime probably benign
R3980:Col4a1 UTSW 8 11239155 intron probably benign
R4120:Col4a1 UTSW 8 11206263 missense unknown
R4152:Col4a1 UTSW 8 11217227 intron probably null
R4437:Col4a1 UTSW 8 11206387 nonsense probably null
R5237:Col4a1 UTSW 8 11245068 unclassified probably benign
R5362:Col4a1 UTSW 8 11245760 unclassified probably benign
R5488:Col4a1 UTSW 8 11312550 unclassified probably benign
R5489:Col4a1 UTSW 8 11312550 unclassified probably benign
R5864:Col4a1 UTSW 8 11202973 utr 3 prime probably benign
R5929:Col4a1 UTSW 8 11216788 missense probably benign 0.17
R6159:Col4a1 UTSW 8 11220007 missense probably damaging 1.00
R6261:Col4a1 UTSW 8 11207409 splice site probably null
R6404:Col4a1 UTSW 8 11207409 splice site probably null
R6520:Col4a1 UTSW 8 11219152 missense probably damaging 1.00
R6862:Col4a1 UTSW 8 11202926 utr 3 prime probably benign
R6974:Col4a1 UTSW 8 11312538 unclassified probably benign
R7329:Col4a1 UTSW 8 11226494 critical splice acceptor site probably null
Z1088:Col4a1 UTSW 8 11246859 splice site probably benign
Z1177:Col4a1 UTSW 8 11235218
Z1177:Col4a1 UTSW 8 11239024
Predicted Primers PCR Primer
(F):5'- TTGGCTACTCTGGAAAGCACACAC -3'
(R):5'- CTCTGCAAGAAGCAACTGGGTCTAC -3'

Sequencing Primer
(F):5'- TCTTCTAAGACATGGACTACCTTG -3'
(R):5'- TCTACCAGGCCCTGACG -3'
Posted On2013-06-11