Incidental Mutation 'R0511:Nwd1'
ID 46920
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene Name NACHT and WD repeat domain containing 1
Synonyms A230063L24Rik
MMRRC Submission 038705-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R0511 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 73372865-73443508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73408633 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 831 (C831Y)
Ref Sequence ENSEMBL: ENSMUSP00000124804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
AlphaFold A6H603
Predicted Effect probably damaging
Transcript: ENSMUST00000093427
AA Change: C831Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: C831Y

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably damaging
Transcript: ENSMUST00000161254
AA Change: C831Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: C831Y

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175535
Predicted Effect possibly damaging
Transcript: ENSMUST00000228312
AA Change: C872Y

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A G 3: 59,843,771 (GRCm39) H155R possibly damaging Het
Abca13 G T 11: 9,244,559 (GRCm39) V2141L probably benign Het
Adam17 T C 12: 21,390,459 (GRCm39) probably benign Het
Adam3 A T 8: 25,185,331 (GRCm39) C456S probably damaging Het
Aldh4a1 G T 4: 139,369,882 (GRCm39) probably benign Het
Anapc4 A G 5: 52,999,359 (GRCm39) probably benign Het
Ank3 A T 10: 69,718,198 (GRCm39) Q483L probably damaging Het
Ankle2 A G 5: 110,389,925 (GRCm39) probably benign Het
Ankrd13b T A 11: 77,364,114 (GRCm39) T150S possibly damaging Het
Apeh A G 9: 107,964,254 (GRCm39) M524T probably benign Het
Arl14epl T A 18: 47,059,484 (GRCm39) probably null Het
Atg2a T C 19: 6,302,569 (GRCm39) F964S possibly damaging Het
Atg2b C T 12: 105,583,412 (GRCm39) V2050M probably damaging Het
Atp2b4 A T 1: 133,659,956 (GRCm39) probably benign Het
Bbof1 T A 12: 84,477,045 (GRCm39) S512T probably benign Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Car10 T C 11: 93,381,408 (GRCm39) Y100H probably damaging Het
Ccdc81 T A 7: 89,542,504 (GRCm39) E124V probably damaging Het
Cd84 A G 1: 171,700,494 (GRCm39) T204A probably benign Het
Celf2 A G 2: 6,608,987 (GRCm39) S178P probably damaging Het
Chat G A 14: 32,130,976 (GRCm39) T555M probably damaging Het
Chd6 A G 2: 160,834,111 (GRCm39) F917S probably damaging Het
Chrna2 C A 14: 66,386,553 (GRCm39) T233N probably damaging Het
Cnpy2 T C 10: 128,162,054 (GRCm39) V109A probably benign Het
Col4a1 T C 8: 11,258,333 (GRCm39) probably null Het
Csmd1 C T 8: 15,982,529 (GRCm39) V2713M possibly damaging Het
Cuedc1 G A 11: 88,074,231 (GRCm39) R255Q probably damaging Het
Cxcl15 A T 5: 90,945,897 (GRCm39) probably benign Het
Dach1 A T 14: 98,138,765 (GRCm39) H559Q possibly damaging Het
Dele1 T C 18: 38,387,124 (GRCm39) probably null Het
Dennd4c C T 4: 86,744,259 (GRCm39) T1367M probably damaging Het
Depdc5 T A 5: 33,102,372 (GRCm39) Y365* probably null Het
Dicer1 T C 12: 104,669,100 (GRCm39) Y1194C possibly damaging Het
Dmxl1 C G 18: 50,024,534 (GRCm39) S1736* probably null Het
Dnah7a C T 1: 53,536,285 (GRCm39) R2586K probably benign Het
Dnajb8 T C 6: 88,199,467 (GRCm39) M1T probably null Het
Dync2h1 G A 9: 7,122,692 (GRCm39) P2088L probably benign Het
Eftud2 T G 11: 102,735,048 (GRCm39) H617P probably damaging Het
Ephb1 A G 9: 101,873,179 (GRCm39) probably benign Het
Fam184a G T 10: 53,574,975 (GRCm39) H155Q probably benign Het
Firrm T C 1: 163,799,412 (GRCm39) probably null Het
Ganc G T 2: 120,278,882 (GRCm39) E700* probably null Het
Gm10912 A G 2: 103,897,290 (GRCm39) probably benign Het
Haus5 A T 7: 30,358,492 (GRCm39) I294N probably damaging Het
Hmgcr G T 13: 96,796,651 (GRCm39) probably null Het
Hr T A 14: 70,799,352 (GRCm39) C641* probably null Het
Itga10 A G 3: 96,565,490 (GRCm39) N1038S probably damaging Het
Itgb1bp1 T G 12: 21,321,436 (GRCm39) Y172S probably damaging Het
Kprp T C 3: 92,732,030 (GRCm39) N340S probably damaging Het
Kremen1 A G 11: 5,165,447 (GRCm39) I41T probably damaging Het
Krt6b A G 15: 101,586,042 (GRCm39) probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Ldhd A G 8: 112,356,309 (GRCm39) Y86H probably benign Het
Lilra6 A T 7: 3,915,784 (GRCm39) I76N possibly damaging Het
Mak T C 13: 41,199,743 (GRCm39) T299A probably benign Het
Med25 A G 7: 44,534,502 (GRCm39) probably null Het
Mpg A T 11: 32,180,039 (GRCm39) N189I probably damaging Het
Mroh8 A G 2: 157,071,838 (GRCm39) Y556H probably damaging Het
Myh8 T A 11: 67,175,333 (GRCm39) S294T probably benign Het
Myom1 T A 17: 71,391,312 (GRCm39) D842E probably benign Het
Myorg A G 4: 41,498,538 (GRCm39) F364S probably damaging Het
Nat2 C T 8: 67,953,982 (GRCm39) Q31* probably null Het
Nf1 T A 11: 79,329,595 (GRCm39) M653K probably benign Het
Nhs C A X: 160,620,355 (GRCm39) R1467I probably damaging Het
Npr2 A G 4: 43,632,801 (GRCm39) E206G probably benign Het
Nsd3 G A 8: 26,168,732 (GRCm39) G629D possibly damaging Het
Or52r1c T C 7: 102,735,058 (GRCm39) I111T probably damaging Het
Or5t9 A G 2: 86,659,950 (GRCm39) I285V probably benign Het
P2ry14 A G 3: 59,023,449 (GRCm39) S4P possibly damaging Het
Parp4 A G 14: 56,873,172 (GRCm39) probably benign Het
Pate14 A T 9: 36,549,873 (GRCm39) probably null Het
Pclo A G 5: 14,728,299 (GRCm39) probably benign Het
Pclo T C 5: 14,729,412 (GRCm39) probably benign Het
Pcnt A T 10: 76,240,429 (GRCm39) S1202T possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pgm2 T A 5: 64,267,898 (GRCm39) V449D probably damaging Het
Poldip3 T A 15: 83,022,436 (GRCm39) D116V probably damaging Het
Pom121 G T 5: 135,410,686 (GRCm39) Q824K unknown Het
Prkdc G T 16: 15,649,146 (GRCm39) G3707* probably null Het
Prr14l T C 5: 33,001,560 (GRCm39) probably benign Het
Ptbp2 T G 3: 119,514,613 (GRCm39) I405L probably benign Het
Rad21l A T 2: 151,490,989 (GRCm39) probably benign Het
Rbm6 G A 9: 107,724,488 (GRCm39) Q488* probably null Het
Rdh1 T A 10: 127,600,652 (GRCm39) M225K probably benign Het
Recql5 T C 11: 115,819,209 (GRCm39) D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo1 T C 16: 72,810,013 (GRCm39) probably null Het
Samd12 G A 15: 53,723,567 (GRCm39) T42I probably benign Het
Scn10a A T 9: 119,442,766 (GRCm39) M1494K probably damaging Het
Sec31a G A 5: 100,523,099 (GRCm39) P864L probably benign Het
Senp2 T C 16: 21,855,320 (GRCm39) V344A probably benign Het
Serpina5 G A 12: 104,069,621 (GRCm39) D278N probably benign Het
Sh3tc1 A T 5: 35,860,806 (GRCm39) V1017D probably damaging Het
Sin3a T A 9: 57,004,179 (GRCm39) Y310* probably null Het
Slc25a32 T C 15: 38,960,940 (GRCm39) T248A probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 G A 2: 62,117,206 (GRCm39) V722M probably damaging Het
Slco1a4 A G 6: 141,776,586 (GRCm39) probably benign Het
Smg6 T A 11: 74,819,884 (GRCm39) Y52N probably damaging Het
Sncb T G 13: 54,913,400 (GRCm39) T33P probably damaging Het
Spef2 A G 15: 9,584,070 (GRCm39) probably null Het
Spmip1 G T 6: 29,478,169 (GRCm39) probably benign Het
Sugp1 A G 8: 70,512,013 (GRCm39) E203G probably damaging Het
Suv39h2 A T 2: 3,473,616 (GRCm39) C105S probably damaging Het
Tlr1 A T 5: 65,083,963 (GRCm39) F205I probably damaging Het
Tnip1 A T 11: 54,808,699 (GRCm39) M496K probably damaging Het
Tnxb G A 17: 34,937,219 (GRCm39) E2889K probably damaging Het
Trim30b T A 7: 104,015,010 (GRCm39) H126L possibly damaging Het
Trpm7 A T 2: 126,668,638 (GRCm39) Y759* probably null Het
Ttc17 A G 2: 94,153,465 (GRCm39) I1000T possibly damaging Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Uba6 T C 5: 86,260,609 (GRCm39) Y990C probably damaging Het
Vav3 A G 3: 109,571,756 (GRCm39) probably benign Het
Vmn2r55 C T 7: 12,404,945 (GRCm39) A153T possibly damaging Het
Wars2 A G 3: 99,123,865 (GRCm39) D242G probably damaging Het
Xylt2 G A 11: 94,560,762 (GRCm39) Q259* probably null Het
Zfp27 G A 7: 29,593,947 (GRCm39) P673S probably damaging Het
Zgrf1 T C 3: 127,378,309 (GRCm39) I1023T possibly damaging Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 73,397,705 (GRCm39) missense probably damaging 0.99
IGL01294:Nwd1 APN 8 73,438,373 (GRCm39) missense probably damaging 1.00
IGL01298:Nwd1 APN 8 73,388,959 (GRCm39) missense probably benign 0.00
IGL01333:Nwd1 APN 8 73,393,439 (GRCm39) missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 73,401,743 (GRCm39) missense probably damaging 1.00
IGL02244:Nwd1 APN 8 73,434,210 (GRCm39) missense probably damaging 1.00
IGL02579:Nwd1 APN 8 73,434,155 (GRCm39) missense probably damaging 1.00
IGL02608:Nwd1 APN 8 73,394,003 (GRCm39) missense probably damaging 1.00
IGL02632:Nwd1 APN 8 73,394,082 (GRCm39) missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 73,394,129 (GRCm39) missense probably damaging 1.00
IGL03010:Nwd1 APN 8 73,414,688 (GRCm39) splice site probably benign
R0017:Nwd1 UTSW 8 73,436,053 (GRCm39) splice site probably benign
R0066:Nwd1 UTSW 8 73,438,484 (GRCm39) missense probably benign 0.27
R0066:Nwd1 UTSW 8 73,438,484 (GRCm39) missense probably benign 0.27
R0505:Nwd1 UTSW 8 73,388,965 (GRCm39) missense probably damaging 0.96
R0612:Nwd1 UTSW 8 73,394,308 (GRCm39) missense probably damaging 0.99
R0681:Nwd1 UTSW 8 73,388,965 (GRCm39) missense probably damaging 0.96
R0763:Nwd1 UTSW 8 73,397,672 (GRCm39) missense probably damaging 1.00
R0905:Nwd1 UTSW 8 73,436,077 (GRCm39) missense probably damaging 0.99
R1136:Nwd1 UTSW 8 73,424,397 (GRCm39) splice site probably benign
R1483:Nwd1 UTSW 8 73,383,714 (GRCm39) missense probably damaging 0.96
R1630:Nwd1 UTSW 8 73,393,657 (GRCm39) missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 73,438,248 (GRCm39) missense probably damaging 1.00
R1732:Nwd1 UTSW 8 73,393,463 (GRCm39) missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 73,431,622 (GRCm39) missense probably benign 0.00
R1973:Nwd1 UTSW 8 73,431,590 (GRCm39) missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 73,389,055 (GRCm39) missense probably benign
R2926:Nwd1 UTSW 8 73,393,640 (GRCm39) missense probably damaging 1.00
R3706:Nwd1 UTSW 8 73,393,744 (GRCm39) missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 73,394,439 (GRCm39) nonsense probably null
R3917:Nwd1 UTSW 8 73,394,439 (GRCm39) nonsense probably null
R4153:Nwd1 UTSW 8 73,408,564 (GRCm39) missense probably damaging 1.00
R4426:Nwd1 UTSW 8 73,393,423 (GRCm39) missense probably damaging 1.00
R4435:Nwd1 UTSW 8 73,414,764 (GRCm39) missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 73,397,579 (GRCm39) missense probably damaging 1.00
R4622:Nwd1 UTSW 8 73,393,928 (GRCm39) missense probably damaging 1.00
R4659:Nwd1 UTSW 8 73,421,949 (GRCm39) missense probably benign 0.03
R4694:Nwd1 UTSW 8 73,393,958 (GRCm39) missense probably damaging 1.00
R4837:Nwd1 UTSW 8 73,383,759 (GRCm39) missense probably damaging 1.00
R4844:Nwd1 UTSW 8 73,393,742 (GRCm39) missense probably damaging 1.00
R4906:Nwd1 UTSW 8 73,398,841 (GRCm39) missense probably damaging 1.00
R5041:Nwd1 UTSW 8 73,431,683 (GRCm39) missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 73,397,714 (GRCm39) missense probably benign 0.07
R5416:Nwd1 UTSW 8 73,393,322 (GRCm39) missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 73,431,604 (GRCm39) missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 73,419,745 (GRCm39) missense probably damaging 0.97
R5699:Nwd1 UTSW 8 73,429,602 (GRCm39) critical splice donor site probably null
R5722:Nwd1 UTSW 8 73,401,872 (GRCm39) missense probably damaging 0.97
R5762:Nwd1 UTSW 8 73,397,542 (GRCm39) missense probably damaging 1.00
R5778:Nwd1 UTSW 8 73,419,745 (GRCm39) missense probably damaging 0.97
R5992:Nwd1 UTSW 8 73,380,201 (GRCm39) critical splice donor site probably null
R6163:Nwd1 UTSW 8 73,388,814 (GRCm39) missense probably damaging 0.96
R6164:Nwd1 UTSW 8 73,388,814 (GRCm39) missense probably damaging 0.96
R6165:Nwd1 UTSW 8 73,388,814 (GRCm39) missense probably damaging 0.96
R6212:Nwd1 UTSW 8 73,421,950 (GRCm39) missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 73,388,994 (GRCm39) missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 73,383,690 (GRCm39) missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 73,408,653 (GRCm39) missense probably benign 0.27
R6944:Nwd1 UTSW 8 73,380,162 (GRCm39) missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 73,394,288 (GRCm39) missense probably damaging 1.00
R7060:Nwd1 UTSW 8 73,393,322 (GRCm39) missense probably damaging 1.00
R7102:Nwd1 UTSW 8 73,421,957 (GRCm39) missense probably damaging 1.00
R7265:Nwd1 UTSW 8 73,419,556 (GRCm39) missense probably benign 0.29
R7343:Nwd1 UTSW 8 73,438,410 (GRCm39) missense probably damaging 0.98
R7391:Nwd1 UTSW 8 73,389,046 (GRCm39) missense probably damaging 0.99
R7424:Nwd1 UTSW 8 73,401,801 (GRCm39) missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 73,434,458 (GRCm39) missense probably benign 0.00
R7487:Nwd1 UTSW 8 73,393,266 (GRCm39) missense unknown
R7502:Nwd1 UTSW 8 73,434,021 (GRCm39) missense probably damaging 0.98
R7883:Nwd1 UTSW 8 73,393,754 (GRCm39) missense probably damaging 1.00
R8235:Nwd1 UTSW 8 73,438,314 (GRCm39) frame shift probably null
R8282:Nwd1 UTSW 8 73,431,580 (GRCm39) missense probably damaging 0.99
R8672:Nwd1 UTSW 8 73,394,007 (GRCm39) missense probably damaging 1.00
R8716:Nwd1 UTSW 8 73,388,908 (GRCm39) missense probably damaging 1.00
R8755:Nwd1 UTSW 8 73,394,192 (GRCm39) missense probably damaging 0.98
R8793:Nwd1 UTSW 8 73,419,704 (GRCm39) missense probably benign
R8890:Nwd1 UTSW 8 73,438,484 (GRCm39) missense probably benign 0.27
R9072:Nwd1 UTSW 8 73,422,046 (GRCm39) missense probably benign 0.00
R9073:Nwd1 UTSW 8 73,422,046 (GRCm39) missense probably benign 0.00
R9257:Nwd1 UTSW 8 73,397,566 (GRCm39) missense probably damaging 1.00
R9582:Nwd1 UTSW 8 73,421,917 (GRCm39) missense probably damaging 1.00
R9665:Nwd1 UTSW 8 73,401,106 (GRCm39) missense probably damaging 1.00
X0067:Nwd1 UTSW 8 73,393,884 (GRCm39) missense possibly damaging 0.81
Z1176:Nwd1 UTSW 8 73,398,928 (GRCm39) missense not run
Z1177:Nwd1 UTSW 8 73,436,087 (GRCm39) missense probably damaging 0.99
Z1177:Nwd1 UTSW 8 73,422,015 (GRCm39) missense possibly damaging 0.48
Z1177:Nwd1 UTSW 8 73,393,256 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCTGTGCTCAGGAAGCAGGGATG -3'
(R):5'- CAGAAAGCCTAGTCAGCATGAGGTG -3'

Sequencing Primer
(F):5'- GCAGGGCCTGAGGTTGAG -3'
(R):5'- CCCGAATACCTGGCATCTG -3'
Posted On 2013-06-11