Incidental Mutation 'R0511:Nwd1'
ID46920
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72682005 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 831 (C831Y)
Ref Sequence ENSEMBL: ENSMUSP00000124804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably damaging
Transcript: ENSMUST00000093427
AA Change: C831Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: C831Y

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably damaging
Transcript: ENSMUST00000161254
AA Change: C831Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: C831Y

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175535
Predicted Effect possibly damaging
Transcript: ENSMUST00000228312
AA Change: C872Y

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1136:Nwd1 UTSW 8 72697769 splice site probably benign
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4435:Nwd1 UTSW 8 72688136 missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4659:Nwd1 UTSW 8 72695321 missense probably benign 0.03
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4844:Nwd1 UTSW 8 72667114 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5699:Nwd1 UTSW 8 72702974 critical splice donor site probably null
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5992:Nwd1 UTSW 8 72653573 critical splice donor site probably null
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense probably damaging 1.00
R7265:Nwd1 UTSW 8 72692928 missense probably benign 0.29
R7343:Nwd1 UTSW 8 72711782 missense probably damaging 0.98
R7391:Nwd1 UTSW 8 72662418 missense probably damaging 0.99
R7424:Nwd1 UTSW 8 72675173 missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 72707830 missense probably benign 0.00
R7487:Nwd1 UTSW 8 72666638 missense unknown
R7502:Nwd1 UTSW 8 72707393 missense probably damaging 0.98
R7883:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
R7966:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTCTGTGCTCAGGAAGCAGGGATG -3'
(R):5'- CAGAAAGCCTAGTCAGCATGAGGTG -3'

Sequencing Primer
(F):5'- GCAGGGCCTGAGGTTGAG -3'
(R):5'- CCCGAATACCTGGCATCTG -3'
Posted On2013-06-11