Incidental Mutation 'R0511:Pcnt'
ID46931
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76404595 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1202 (S1202T)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001179
AA Change: S1202T

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: S1202T

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190491
Predicted Effect possibly damaging
Transcript: ENSMUST00000217838
AA Change: S1202T

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220395
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 intron probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
R7538:Pcnt UTSW 10 76399939 missense probably benign
R7575:Pcnt UTSW 10 76389252 missense probably benign 0.32
R7662:Pcnt UTSW 10 76387522 missense probably benign 0.27
R7685:Pcnt UTSW 10 76422808 missense probably benign 0.14
R7764:Pcnt UTSW 10 76354248 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCTCCTTACATCCATGAACTGACGC -3'
(R):5'- GCTTGAATCTCACGCCAGCCATAG -3'

Sequencing Primer
(F):5'- ATGAACTGACGCTGGCTAC -3'
(R):5'- ACGGTTGTCTCCTAAGCG -3'
Posted On2013-06-11