Mutagenetix > Incidental Mutation

Incidental Mutation 'R0511:Nf1'

46941

Institutional Source

Beutler Lab

Gene Symbol

Nf1

Ensembl Gene

ENSMUSG00000020716

Gene Name

neurofibromin 1

Synonyms

Nf-1, neurofibromin

MMRRC Submission

038705-MU

Accession Numbers

Genbank: NM_010897; MGI: 97306

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0511 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79339693-79581612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79438769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 653 (M653K)

Ref Sequence

ENSEMBL: ENSMUSP00000151975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000071325
AA Change: M643K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: M643K

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108251
AA Change: M643K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: M643K

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219057
AA Change: M653K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.0811

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (116/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,254,071		probably null	Het
A630095E13Rik	A	T	9: 36,638,577		probably null	Het
Abca13	G	T	11: 9,294,559	V2141L	probably benign	Het
Adam17	T	C	12: 21,340,458		probably benign	Het
Adam3	A	T	8: 24,695,315	C456S	probably damaging	Het
AI464131	A	G	4: 41,498,538	F364S	probably damaging	Het
Aldh4a1	G	T	4: 139,642,571		probably benign	Het
Anapc4	A	G	5: 52,842,017		probably benign	Het
Ank3	A	T	10: 69,882,368	Q483L	probably damaging	Het
Ankle2	A	G	5: 110,242,059		probably benign	Het
Ankrd13b	T	A	11: 77,473,288	T150S	possibly damaging	Het
Apeh	A	G	9: 108,087,055	M524T	probably benign	Het
Arl14epl	T	A	18: 46,926,417		probably null	Het
Atg2a	T	C	19: 6,252,539	F964S	possibly damaging	Het
Atg2b	C	T	12: 105,617,153	V2050M	probably damaging	Het
Atp2b4	A	T	1: 133,732,218		probably benign	Het
Bbof1	T	A	12: 84,430,271	S512T	probably benign	Het
BC055324	T	C	1: 163,971,843		probably null	Het
C130079G13Rik	A	G	3: 59,936,350	H155R	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Car10	T	C	11: 93,490,582	Y100H	probably damaging	Het
Ccdc81	T	A	7: 89,893,296	E124V	probably damaging	Het
Cd84	A	G	1: 171,872,927	T204A	probably benign	Het
Celf2	A	G	2: 6,604,176	S178P	probably damaging	Het
Chat	G	A	14: 32,409,019	T555M	probably damaging	Het
Chd6	A	G	2: 160,992,191	F917S	probably damaging	Het
Chrna2	C	A	14: 66,149,104	T233N	probably damaging	Het
Cnpy2	T	C	10: 128,326,185	V109A	probably benign	Het
Col4a1	T	C	8: 11,208,333		probably null	Het
Csmd1	C	T	8: 15,932,529	V2713M	possibly damaging	Het
Cuedc1	G	A	11: 88,183,405	R255Q	probably damaging	Het
Cxcl15	A	T	5: 90,798,038		probably benign	Het
Dach1	A	T	14: 97,901,329	H559Q	possibly damaging	Het
Dennd4c	C	T	4: 86,826,022	T1367M	probably damaging	Het
Depdc5	T	A	5: 32,945,028	Y365*	probably null	Het
Dicer1	T	C	12: 104,702,841	Y1194C	possibly damaging	Het
Dmxl1	C	G	18: 49,891,467	S1736*	probably null	Het
Dnah7a	C	T	1: 53,497,126	R2586K	probably benign	Het
Dnajb8	T	C	6: 88,222,485	M1T	probably null	Het
Dync2h1	G	A	9: 7,122,692	P2088L	probably benign	Het
Eftud2	T	G	11: 102,844,222	H617P	probably damaging	Het
Ephb1	A	G	9: 101,995,980		probably benign	Het
Fam184a	G	T	10: 53,698,879	H155Q	probably benign	Het
Ganc	G	T	2: 120,448,401	E700*	probably null	Het
Gm10912	A	G	2: 104,066,945		probably benign	Het
Gm9047	G	T	6: 29,478,170		probably benign	Het
Haus5	A	T	7: 30,659,067	I294N	probably damaging	Het
Hmgcr	G	T	13: 96,660,143		probably null	Het
Hr	T	A	14: 70,561,912	C641*	probably null	Het
Itga10	A	G	3: 96,658,174	N1038S	probably damaging	Het
Itgb1bp1	T	G	12: 21,271,435	Y172S	probably damaging	Het
Kprp	T	C	3: 92,824,723	N340S	probably damaging	Het
Kremen1	A	G	11: 5,215,447	I41T	probably damaging	Het
Krt6b	A	G	15: 101,677,607		probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Ldhd	A	G	8: 111,629,677	Y86H	probably benign	Het
Lilra6	A	T	7: 3,912,785	I76N	possibly damaging	Het
Mak	T	C	13: 41,046,267	T299A	probably benign	Het
Med25	A	G	7: 44,885,078		probably null	Het
Mpg	A	T	11: 32,230,039	N189I	probably damaging	Het
Mroh8	A	G	2: 157,229,918	Y556H	probably damaging	Het
Myh8	T	A	11: 67,284,507	S294T	probably benign	Het
Myom1	T	A	17: 71,084,317	D842E	probably benign	Het
Nat2	C	T	8: 67,501,330	Q31*	probably null	Het
Nhs	C	A	X: 161,837,359	R1467I	probably damaging	Het
Npr2	A	G	4: 43,632,801	E206G	probably benign	Het
Nsd3	G	A	8: 25,678,716	G629D	possibly damaging	Het
Nwd1	G	A	8: 72,682,005	C831Y	probably damaging	Het
Olfr1094	A	G	2: 86,829,606	I285V	probably benign	Het
Olfr584	T	C	7: 103,085,851	I111T	probably damaging	Het
P2ry14	A	G	3: 59,116,028	S4P	possibly damaging	Het
Parp4	A	G	14: 56,635,715		probably benign	Het
Pclo	A	G	5: 14,678,285		probably benign	Het
Pclo	T	C	5: 14,679,398		probably benign	Het
Pcnt	A	T	10: 76,404,595	S1202T	possibly damaging	Het
Pfkfb4	A	G	9: 109,027,757	Y412C	probably damaging	Het
Pgm1	T	A	5: 64,110,555	V449D	probably damaging	Het
Poldip3	T	A	15: 83,138,235	D116V	probably damaging	Het
Pom121	G	T	5: 135,381,832	Q824K	unknown	Het
Prkdc	G	T	16: 15,831,282	G3707*	probably null	Het
Prr14l	T	C	5: 32,844,216		probably benign	Het
Ptbp2	T	G	3: 119,720,964	I405L	probably benign	Het
Rad21l	A	T	2: 151,649,069		probably benign	Het
Rbm6	G	A	9: 107,847,289	Q488*	probably null	Het
Rdh1	T	A	10: 127,764,783	M225K	probably benign	Het
Recql5	T	C	11: 115,928,383	D119G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo1	T	C	16: 73,013,125		probably null	Het
Samd12	G	A	15: 53,860,171	T42I	probably benign	Het
Scn10a	A	T	9: 119,613,700	M1494K	probably damaging	Het
Sec31a	G	A	5: 100,375,240	P864L	probably benign	Het
Senp2	T	C	16: 22,036,570	V344A	probably benign	Het
Serpina5	G	A	12: 104,103,362	D278N	probably benign	Het
Sh3tc1	A	T	5: 35,703,462	V1017D	probably damaging	Het
Sin3a	T	A	9: 57,096,895	Y310*	probably null	Het
Slc25a32	T	C	15: 39,097,545	T248A	probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	G	A	2: 62,286,862	V722M	probably damaging	Het
Slco1a4	A	G	6: 141,830,860		probably benign	Het
Smg6	T	A	11: 74,929,058	Y52N	probably damaging	Het
Sncb	T	G	13: 54,765,587	T33P	probably damaging	Het
Spef2	A	G	15: 9,583,984		probably null	Het
Sugp1	A	G	8: 70,059,363	E203G	probably damaging	Het
Suv39h2	A	T	2: 3,472,579	C105S	probably damaging	Het
Tlr1	A	T	5: 64,926,620	F205I	probably damaging	Het
Tnip1	A	T	11: 54,917,873	M496K	probably damaging	Het
Tnxb	G	A	17: 34,718,245	E2889K	probably damaging	Het
Trim30b	T	A	7: 104,365,803	H126L	possibly damaging	Het
Trpm7	A	T	2: 126,826,718	Y759*	probably null	Het
Ttc17	A	G	2: 94,323,120	I1000T	possibly damaging	Het
Ttc27	A	T	17: 74,718,715	N61I	probably benign	Het
Uba6	T	C	5: 86,112,750	Y990C	probably damaging	Het
Vav3	A	G	3: 109,664,440		probably benign	Het
Vmn2r55	C	T	7: 12,671,018	A153T	possibly damaging	Het
Wars2	A	G	3: 99,216,549	D242G	probably damaging	Het
Xylt2	G	A	11: 94,669,936	Q259*	probably null	Het
Zfp27	G	A	7: 29,894,522	P673S	probably damaging	Het
Zgrf1	T	C	3: 127,584,660	I1023T	possibly damaging	Het

Other mutations in Nf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Nf1	APN	11	79395905	missense	probably damaging	0.99
IGL00801:Nf1	APN	11	79428700	splice site	probably benign
IGL00823:Nf1	APN	11	79565517	missense	probably damaging	1.00
IGL00945:Nf1	APN	11	79469803	missense	probably damaging	0.99
IGL00960:Nf1	APN	11	79445121	missense	probably damaging	1.00
IGL01118:Nf1	APN	11	79546986	missense	probably damaging	0.99
IGL01604:Nf1	APN	11	79441709	splice site	probably benign
IGL01637:Nf1	APN	11	79547120	missense	probably damaging	1.00
IGL01659:Nf1	APN	11	79559449	missense	probably benign
IGL01764:Nf1	APN	11	79384187	missense	probably benign
IGL01772:Nf1	APN	11	79390249	missense	probably damaging	1.00
IGL02047:Nf1	APN	11	79425535	missense	probably benign	0.04
IGL02052:Nf1	APN	11	79412727	missense	probably damaging	1.00
IGL02071:Nf1	APN	11	79444121	missense	possibly damaging	0.96
IGL02312:Nf1	APN	11	79444648	missense	possibly damaging	0.95
IGL02341:Nf1	APN	11	79564926	missense	probably benign	0.33
IGL02390:Nf1	APN	11	79565935	missense	possibly damaging	0.64
IGL02390:Nf1	APN	11	79411676	splice site	probably benign
IGL02475:Nf1	APN	11	79535667	missense	probably damaging	1.00
IGL02567:Nf1	APN	11	79547143	missense	probably damaging	1.00
IGL02571:Nf1	APN	11	79428627	missense	probably damaging	1.00
IGL02664:Nf1	APN	11	79444598	critical splice acceptor site	probably null
IGL02664:Nf1	APN	11	79444599	critical splice acceptor site	probably null
IGL02992:Nf1	APN	11	79434933	splice site	probably benign
IGL03006:Nf1	APN	11	79545431	missense	probably damaging	1.00
IGL03216:Nf1	APN	11	79564895	missense	probably benign	0.17
Diesel	UTSW	11	79556723	missense	probably damaging	0.96
Eyecandy	UTSW	11	79545465	missense	probably damaging	1.00
Franklin	UTSW	11	79473320	splice site	probably null
Gasoline	UTSW	11	79556789	missense	probably benign	0.17
hancock	UTSW	11	79536850	missense	probably benign
independence	UTSW	11	79454310	intron	probably benign
jackson	UTSW	11	79447572	missense	probably damaging	1.00
Jefferson	UTSW	11	79446864	missense	probably damaging	1.00
Phyletic_dwarf	UTSW	11	79454189	missense	probably damaging	1.00
responsibility	UTSW	11	79565975	missense	probably damaging	0.99
weepy	UTSW	11	79546986	missense	probably damaging	1.00
C9142:Nf1	UTSW	11	79556731	missense	probably damaging	0.98
I2289:Nf1	UTSW	11	79547776	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0081:Nf1	UTSW	11	79453979	splice site	probably benign
R0115:Nf1	UTSW	11	79468876	critical splice donor site	probably null
R0144:Nf1	UTSW	11	79547127	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R0196:Nf1	UTSW	11	79578272	missense	probably damaging	1.00
R0217:Nf1	UTSW	11	79428574	splice site	probably benign
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0255:Nf1	UTSW	11	79408699	splice site	probably null
R0362:Nf1	UTSW	11	79536878	missense	probably damaging	1.00
R0364:Nf1	UTSW	11	79441957	nonsense	probably null
R0464:Nf1	UTSW	11	79556789	missense	probably benign	0.17
R0549:Nf1	UTSW	11	79468771	missense	probably damaging	0.99
R0585:Nf1	UTSW	11	79568701	missense	probably damaging	0.99
R0636:Nf1	UTSW	11	79535703	missense	probably damaging	0.99
R0924:Nf1	UTSW	11	79453866	missense	probably damaging	0.98
R0942:Nf1	UTSW	11	79438711	missense	probably benign	0.00
R1022:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1024:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1350:Nf1	UTSW	11	79412687	missense	probably damaging	1.00
R1365:Nf1	UTSW	11	79547885	splice site	probably null
R1395:Nf1	UTSW	11	79535983	missense	possibly damaging	0.49
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1477:Nf1	UTSW	11	79395859	nonsense	probably null
R1508:Nf1	UTSW	11	79440909	missense	probably damaging	1.00
R1512:Nf1	UTSW	11	79390369	missense	probably damaging	1.00
R1605:Nf1	UTSW	11	79440923	missense	probably benign	0.01
R1680:Nf1	UTSW	11	79550998	nonsense	probably null
R1704:Nf1	UTSW	11	79463301	splice site	probably null
R1707:Nf1	UTSW	11	79535604	missense	probably damaging	1.00
R1741:Nf1	UTSW	11	79443931	missense	probably benign
R1761:Nf1	UTSW	11	79384265	missense	probably damaging	1.00
R1800:Nf1	UTSW	11	79553968	missense	possibly damaging	0.94
R1873:Nf1	UTSW	11	79547161	missense	probably damaging	1.00
R1966:Nf1	UTSW	11	79411564	missense	possibly damaging	0.72
R1967:Nf1	UTSW	11	79412745	missense	probably damaging	0.96
R1970:Nf1	UTSW	11	79553961	missense	probably benign	0.08
R2059:Nf1	UTSW	11	79556723	missense	probably damaging	0.96
R2105:Nf1	UTSW	11	79469826	missense	possibly damaging	0.50
R2151:Nf1	UTSW	11	79447570	missense	possibly damaging	0.94
R2211:Nf1	UTSW	11	79444064	missense	probably benign	0.39
R2497:Nf1	UTSW	11	79443884	missense	probably damaging	1.00
R2899:Nf1	UTSW	11	79412758	missense	possibly damaging	0.93
R3086:Nf1	UTSW	11	79546986	missense	probably damaging	1.00
R3120:Nf1	UTSW	11	79564899	missense	probably damaging	0.99
R3744:Nf1	UTSW	11	79548747	missense	probably benign	0.23
R3801:Nf1	UTSW	11	79559521	missense	probably null	0.98
R3804:Nf1	UTSW	11	79559521	missense	probably null	0.98
R4212:Nf1	UTSW	11	79469798	missense	probably damaging	1.00
R4298:Nf1	UTSW	11	79384244	missense	probably damaging	1.00
R4578:Nf1	UTSW	11	79445759	missense	probably damaging	1.00
R4579:Nf1	UTSW	11	79468757	missense	probably damaging	1.00
R4587:Nf1	UTSW	11	79536037	critical splice donor site	probably null
R4793:Nf1	UTSW	11	79447572	missense	probably damaging	1.00
R4834:Nf1	UTSW	11	79546297	missense	probably damaging	1.00
R4863:Nf1	UTSW	11	79409409	missense	probably damaging	1.00
R4967:Nf1	UTSW	11	79565553	critical splice donor site	probably null
R4971:Nf1	UTSW	11	79444643	missense	probably damaging	1.00
R5034:Nf1	UTSW	11	79444150	missense	probably damaging	0.98
R5036:Nf1	UTSW	11	79446864	missense	probably damaging	1.00
R5207:Nf1	UTSW	11	79454189	missense	probably damaging	1.00
R5348:Nf1	UTSW	11	79564899	missense	probably damaging	1.00
R5356:Nf1	UTSW	11	79473456	missense	possibly damaging	0.94
R5444:Nf1	UTSW	11	79443959	missense	possibly damaging	0.94
R5533:Nf1	UTSW	11	79445789	missense	probably damaging	0.99
R5918:Nf1	UTSW	11	79569222	intron	probably benign
R5978:Nf1	UTSW	11	79540419	missense	probably damaging	1.00
R6140:Nf1	UTSW	11	79473320	splice site	probably null
R6195:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6216:Nf1	UTSW	11	79411607	missense	possibly damaging	0.93
R6233:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6257:Nf1	UTSW	11	79549491	missense	probably damaging	1.00
R6258:Nf1	UTSW	11	79565755	splice site	probably null
R6756:Nf1	UTSW	11	79444587	splice site	probably null
R6878:Nf1	UTSW	11	79434882	missense	probably damaging	1.00
R6959:Nf1	UTSW	11	79549468	missense	probably damaging	0.98
R7007:Nf1	UTSW	11	79447023	splice site	probably null
R7066:Nf1	UTSW	11	79556720	missense	probably damaging	1.00
R7099:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R7213:Nf1	UTSW	11	79469819	missense	probably benign	0.23
R7326:Nf1	UTSW	11	79564943	missense	probably benign
R7348:Nf1	UTSW	11	79536850	missense	probably benign
R7380:Nf1	UTSW	11	79546276	missense	probably damaging	1.00
R7407:Nf1	UTSW	11	79448143	missense	probably damaging	1.00
R7412:Nf1	UTSW	11	79473414	missense	probably damaging	1.00
R7545:Nf1	UTSW	11	79409524	missense	probably benign
R7567:Nf1	UTSW	11	79547226	missense	probably damaging	0.99
R7574:Nf1	UTSW	11	79408769	missense	probably null	0.99
R7616:Nf1	UTSW	11	79384266	missense	probably damaging	0.97
R7713:Nf1	UTSW	11	79425606	missense	probably benign
R7737:Nf1	UTSW	11	79545488	missense	probably benign	0.33
R7869:Nf1	UTSW	11	79418588	missense	probably damaging	1.00
R7905:Nf1	UTSW	11	79547112	missense	possibly damaging	0.80
R8232:Nf1	UTSW	11	79578331	missense	probably damaging	0.96
R8244:Nf1	UTSW	11	79440924	missense	probably benign
R8397:Nf1	UTSW	11	79547692	missense	probably damaging	1.00
R8436:Nf1	UTSW	11	79458883	missense	probably damaging	0.99
R8492:Nf1	UTSW	11	79408422	missense	probably benign	0.06
R8719:Nf1	UTSW	11	79390293	missense	possibly damaging	0.86
R8735:Nf1	UTSW	11	79454310	intron	probably benign
R8795:Nf1	UTSW	11	79425616	missense	probably damaging	1.00
R8797:Nf1	UTSW	11	79475885	critical splice donor site	probably benign
R8809:Nf1	UTSW	11	79547138	missense	probably damaging	0.99
R8812:Nf1	UTSW	11	79546354	missense	probably damaging	0.96
R8815:Nf1	UTSW	11	79441665	missense	probably damaging	1.00
R8828:Nf1	UTSW	11	79395853	critical splice acceptor site	probably null
R8894:Nf1	UTSW	11	79445793	missense	probably damaging	1.00
R9051:Nf1	UTSW	11	79473342	missense	probably damaging	1.00
R9103:Nf1	UTSW	11	79559506	missense	probably damaging	0.99
R9142:Nf1	UTSW	11	79471489	missense	probably damaging	1.00
R9142:Nf1	UTSW	11	79475862	missense	probably damaging	1.00
R9170:Nf1	UTSW	11	79545465	missense	probably damaging	1.00
R9201:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R9267:Nf1	UTSW	11	79440890	missense	possibly damaging	0.72
R9309:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R9340:Nf1	UTSW	11	79556803	missense	possibly damaging	0.90
R9398:Nf1	UTSW	11	79547192	missense	probably damaging	0.99
R9471:Nf1	UTSW	11	79545369	missense	probably damaging	0.99
R9630:Nf1	UTSW	11	79411644	missense	probably damaging	1.00
R9664:Nf1	UTSW	11	79443907	missense	probably damaging	1.00
X0052:Nf1	UTSW	11	79559416	missense	probably damaging	0.99
Z1177:Nf1	UTSW	11	79564925	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAAAGTCAGTTCCCACTAAGCACTCT -3'
(R):5'- GTAAACCTACCTTCAAACTTGTCCCCTC -3'

Sequencing Primer
(F):5'- ACTAAGCACTCTGTCAGTGTC -3'
(R):5'- tcctcttgcctcagcctc -3'

Posted On

2013-06-11