Incidental Mutation 'R0511:Car10'
ID 46943
Institutional Source Beutler Lab
Gene Symbol Car10
Ensembl Gene ENSMUSG00000056158
Gene Name carbonic anhydrase 10
Synonyms CA-RP X, 2700029L05Rik
MMRRC Submission 038705-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.570) question?
Stock # R0511 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 92988854-93492575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93381408 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 100 (Y100H)
Ref Sequence ENSEMBL: ENSMUSP00000103490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042943] [ENSMUST00000107858] [ENSMUST00000107861] [ENSMUST00000107863]
AlphaFold P61215
Predicted Effect probably damaging
Transcript: ENSMUST00000042943
AA Change: Y124H

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035585
Gene: ENSMUSG00000056158
AA Change: Y124H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107858
AA Change: Y100H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103490
Gene: ENSMUSG00000056158
AA Change: Y100H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 277 2.21e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107861
AA Change: Y124H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103493
Gene: ENSMUSG00000056158
AA Change: Y124H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 169 2.14e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107863
AA Change: Y124H

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103495
Gene: ENSMUSG00000056158
AA Change: Y124H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Meta Mutation Damage Score 0.1913 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A G 3: 59,843,771 (GRCm39) H155R possibly damaging Het
Abca13 G T 11: 9,244,559 (GRCm39) V2141L probably benign Het
Adam17 T C 12: 21,390,459 (GRCm39) probably benign Het
Adam3 A T 8: 25,185,331 (GRCm39) C456S probably damaging Het
Aldh4a1 G T 4: 139,369,882 (GRCm39) probably benign Het
Anapc4 A G 5: 52,999,359 (GRCm39) probably benign Het
Ank3 A T 10: 69,718,198 (GRCm39) Q483L probably damaging Het
Ankle2 A G 5: 110,389,925 (GRCm39) probably benign Het
Ankrd13b T A 11: 77,364,114 (GRCm39) T150S possibly damaging Het
Apeh A G 9: 107,964,254 (GRCm39) M524T probably benign Het
Arl14epl T A 18: 47,059,484 (GRCm39) probably null Het
Atg2a T C 19: 6,302,569 (GRCm39) F964S possibly damaging Het
Atg2b C T 12: 105,583,412 (GRCm39) V2050M probably damaging Het
Atp2b4 A T 1: 133,659,956 (GRCm39) probably benign Het
Bbof1 T A 12: 84,477,045 (GRCm39) S512T probably benign Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ccdc81 T A 7: 89,542,504 (GRCm39) E124V probably damaging Het
Cd84 A G 1: 171,700,494 (GRCm39) T204A probably benign Het
Celf2 A G 2: 6,608,987 (GRCm39) S178P probably damaging Het
Chat G A 14: 32,130,976 (GRCm39) T555M probably damaging Het
Chd6 A G 2: 160,834,111 (GRCm39) F917S probably damaging Het
Chrna2 C A 14: 66,386,553 (GRCm39) T233N probably damaging Het
Cnpy2 T C 10: 128,162,054 (GRCm39) V109A probably benign Het
Col4a1 T C 8: 11,258,333 (GRCm39) probably null Het
Csmd1 C T 8: 15,982,529 (GRCm39) V2713M possibly damaging Het
Cuedc1 G A 11: 88,074,231 (GRCm39) R255Q probably damaging Het
Cxcl15 A T 5: 90,945,897 (GRCm39) probably benign Het
Dach1 A T 14: 98,138,765 (GRCm39) H559Q possibly damaging Het
Dele1 T C 18: 38,387,124 (GRCm39) probably null Het
Dennd4c C T 4: 86,744,259 (GRCm39) T1367M probably damaging Het
Depdc5 T A 5: 33,102,372 (GRCm39) Y365* probably null Het
Dicer1 T C 12: 104,669,100 (GRCm39) Y1194C possibly damaging Het
Dmxl1 C G 18: 50,024,534 (GRCm39) S1736* probably null Het
Dnah7a C T 1: 53,536,285 (GRCm39) R2586K probably benign Het
Dnajb8 T C 6: 88,199,467 (GRCm39) M1T probably null Het
Dync2h1 G A 9: 7,122,692 (GRCm39) P2088L probably benign Het
Eftud2 T G 11: 102,735,048 (GRCm39) H617P probably damaging Het
Ephb1 A G 9: 101,873,179 (GRCm39) probably benign Het
Fam184a G T 10: 53,574,975 (GRCm39) H155Q probably benign Het
Firrm T C 1: 163,799,412 (GRCm39) probably null Het
Ganc G T 2: 120,278,882 (GRCm39) E700* probably null Het
Gm10912 A G 2: 103,897,290 (GRCm39) probably benign Het
Haus5 A T 7: 30,358,492 (GRCm39) I294N probably damaging Het
Hmgcr G T 13: 96,796,651 (GRCm39) probably null Het
Hr T A 14: 70,799,352 (GRCm39) C641* probably null Het
Itga10 A G 3: 96,565,490 (GRCm39) N1038S probably damaging Het
Itgb1bp1 T G 12: 21,321,436 (GRCm39) Y172S probably damaging Het
Kprp T C 3: 92,732,030 (GRCm39) N340S probably damaging Het
Kremen1 A G 11: 5,165,447 (GRCm39) I41T probably damaging Het
Krt6b A G 15: 101,586,042 (GRCm39) probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Ldhd A G 8: 112,356,309 (GRCm39) Y86H probably benign Het
Lilra6 A T 7: 3,915,784 (GRCm39) I76N possibly damaging Het
Mak T C 13: 41,199,743 (GRCm39) T299A probably benign Het
Med25 A G 7: 44,534,502 (GRCm39) probably null Het
Mpg A T 11: 32,180,039 (GRCm39) N189I probably damaging Het
Mroh8 A G 2: 157,071,838 (GRCm39) Y556H probably damaging Het
Myh8 T A 11: 67,175,333 (GRCm39) S294T probably benign Het
Myom1 T A 17: 71,391,312 (GRCm39) D842E probably benign Het
Myorg A G 4: 41,498,538 (GRCm39) F364S probably damaging Het
Nat2 C T 8: 67,953,982 (GRCm39) Q31* probably null Het
Nf1 T A 11: 79,329,595 (GRCm39) M653K probably benign Het
Nhs C A X: 160,620,355 (GRCm39) R1467I probably damaging Het
Npr2 A G 4: 43,632,801 (GRCm39) E206G probably benign Het
Nsd3 G A 8: 26,168,732 (GRCm39) G629D possibly damaging Het
Nwd1 G A 8: 73,408,633 (GRCm39) C831Y probably damaging Het
Or52r1c T C 7: 102,735,058 (GRCm39) I111T probably damaging Het
Or5t9 A G 2: 86,659,950 (GRCm39) I285V probably benign Het
P2ry14 A G 3: 59,023,449 (GRCm39) S4P possibly damaging Het
Parp4 A G 14: 56,873,172 (GRCm39) probably benign Het
Pate14 A T 9: 36,549,873 (GRCm39) probably null Het
Pclo A G 5: 14,728,299 (GRCm39) probably benign Het
Pclo T C 5: 14,729,412 (GRCm39) probably benign Het
Pcnt A T 10: 76,240,429 (GRCm39) S1202T possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pgm2 T A 5: 64,267,898 (GRCm39) V449D probably damaging Het
Poldip3 T A 15: 83,022,436 (GRCm39) D116V probably damaging Het
Pom121 G T 5: 135,410,686 (GRCm39) Q824K unknown Het
Prkdc G T 16: 15,649,146 (GRCm39) G3707* probably null Het
Prr14l T C 5: 33,001,560 (GRCm39) probably benign Het
Ptbp2 T G 3: 119,514,613 (GRCm39) I405L probably benign Het
Rad21l A T 2: 151,490,989 (GRCm39) probably benign Het
Rbm6 G A 9: 107,724,488 (GRCm39) Q488* probably null Het
Rdh1 T A 10: 127,600,652 (GRCm39) M225K probably benign Het
Recql5 T C 11: 115,819,209 (GRCm39) D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo1 T C 16: 72,810,013 (GRCm39) probably null Het
Samd12 G A 15: 53,723,567 (GRCm39) T42I probably benign Het
Scn10a A T 9: 119,442,766 (GRCm39) M1494K probably damaging Het
Sec31a G A 5: 100,523,099 (GRCm39) P864L probably benign Het
Senp2 T C 16: 21,855,320 (GRCm39) V344A probably benign Het
Serpina5 G A 12: 104,069,621 (GRCm39) D278N probably benign Het
Sh3tc1 A T 5: 35,860,806 (GRCm39) V1017D probably damaging Het
Sin3a T A 9: 57,004,179 (GRCm39) Y310* probably null Het
Slc25a32 T C 15: 38,960,940 (GRCm39) T248A probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 G A 2: 62,117,206 (GRCm39) V722M probably damaging Het
Slco1a4 A G 6: 141,776,586 (GRCm39) probably benign Het
Smg6 T A 11: 74,819,884 (GRCm39) Y52N probably damaging Het
Sncb T G 13: 54,913,400 (GRCm39) T33P probably damaging Het
Spef2 A G 15: 9,584,070 (GRCm39) probably null Het
Spmip1 G T 6: 29,478,169 (GRCm39) probably benign Het
Sugp1 A G 8: 70,512,013 (GRCm39) E203G probably damaging Het
Suv39h2 A T 2: 3,473,616 (GRCm39) C105S probably damaging Het
Tlr1 A T 5: 65,083,963 (GRCm39) F205I probably damaging Het
Tnip1 A T 11: 54,808,699 (GRCm39) M496K probably damaging Het
Tnxb G A 17: 34,937,219 (GRCm39) E2889K probably damaging Het
Trim30b T A 7: 104,015,010 (GRCm39) H126L possibly damaging Het
Trpm7 A T 2: 126,668,638 (GRCm39) Y759* probably null Het
Ttc17 A G 2: 94,153,465 (GRCm39) I1000T possibly damaging Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Uba6 T C 5: 86,260,609 (GRCm39) Y990C probably damaging Het
Vav3 A G 3: 109,571,756 (GRCm39) probably benign Het
Vmn2r55 C T 7: 12,404,945 (GRCm39) A153T possibly damaging Het
Wars2 A G 3: 99,123,865 (GRCm39) D242G probably damaging Het
Xylt2 G A 11: 94,560,762 (GRCm39) Q259* probably null Het
Zfp27 G A 7: 29,593,947 (GRCm39) P673S probably damaging Het
Zgrf1 T C 3: 127,378,309 (GRCm39) I1023T possibly damaging Het
Other mutations in Car10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Car10 APN 11 93,195,483 (GRCm39) splice site probably benign
IGL01077:Car10 APN 11 93,487,969 (GRCm39) missense possibly damaging 0.54
IGL01099:Car10 APN 11 93,469,516 (GRCm39) missense possibly damaging 0.91
IGL02810:Car10 APN 11 93,469,522 (GRCm39) missense probably damaging 1.00
IGL03037:Car10 APN 11 92,991,044 (GRCm39) utr 5 prime probably benign
IGL03061:Car10 APN 11 93,381,351 (GRCm39) missense probably damaging 0.98
IGL03105:Car10 APN 11 92,991,101 (GRCm39) missense probably benign 0.07
IGL03347:Car10 APN 11 92,991,122 (GRCm39) splice site probably benign
IGL02837:Car10 UTSW 11 93,488,077 (GRCm39) missense probably damaging 0.96
R0076:Car10 UTSW 11 93,381,423 (GRCm39) missense possibly damaging 0.93
R0076:Car10 UTSW 11 93,381,423 (GRCm39) missense possibly damaging 0.93
R0387:Car10 UTSW 11 93,473,847 (GRCm39) critical splice donor site probably null
R1372:Car10 UTSW 11 93,469,525 (GRCm39) missense probably benign 0.02
R4692:Car10 UTSW 11 93,075,984 (GRCm39) critical splice donor site probably null
R4799:Car10 UTSW 11 93,469,492 (GRCm39) missense possibly damaging 0.81
R5947:Car10 UTSW 11 93,381,439 (GRCm39) missense probably damaging 1.00
R6010:Car10 UTSW 11 93,490,149 (GRCm39) missense possibly damaging 0.52
R6013:Car10 UTSW 11 93,076,105 (GRCm39) intron probably benign
R7268:Car10 UTSW 11 93,490,077 (GRCm39) missense probably benign 0.26
R7995:Car10 UTSW 11 93,487,948 (GRCm39) missense probably damaging 0.99
R9717:Car10 UTSW 11 93,195,367 (GRCm39) missense probably benign 0.12
Z1191:Car10 UTSW 11 93,195,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCTTCTGCACACAGATTTAGCC -3'
(R):5'- TCACTGTAGCCTCTTCTGGGAAACC -3'

Sequencing Primer
(F):5'- GCACACAGATTTAGCCTGGTG -3'
(R):5'- GAGGCACAGATTTTCTTTCTCAG -3'
Posted On 2013-06-11