Mutagenetix > Incidental Mutation

Incidental Mutation 'R0511:Dicer1'

46951

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

038705-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0511 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104702841 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1194 (Y1194C)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041987
AA Change: Y1194C

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: Y1194C

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Meta Mutation Damage Score

0.1893

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (116/116)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,254,071		probably null	Het
A630095E13Rik	A	T	9: 36,638,577		probably null	Het
Abca13	G	T	11: 9,294,559	V2141L	probably benign	Het
Adam17	T	C	12: 21,340,458		probably benign	Het
Adam3	A	T	8: 24,695,315	C456S	probably damaging	Het
AI464131	A	G	4: 41,498,538	F364S	probably damaging	Het
Aldh4a1	G	T	4: 139,642,571		probably benign	Het
Anapc4	A	G	5: 52,842,017		probably benign	Het
Ank3	A	T	10: 69,882,368	Q483L	probably damaging	Het
Ankle2	A	G	5: 110,242,059		probably benign	Het
Ankrd13b	T	A	11: 77,473,288	T150S	possibly damaging	Het
Apeh	A	G	9: 108,087,055	M524T	probably benign	Het
Arl14epl	T	A	18: 46,926,417		probably null	Het
Atg2a	T	C	19: 6,252,539	F964S	possibly damaging	Het
Atg2b	C	T	12: 105,617,153	V2050M	probably damaging	Het
Atp2b4	A	T	1: 133,732,218		probably benign	Het
Bbof1	T	A	12: 84,430,271	S512T	probably benign	Het
BC055324	T	C	1: 163,971,843		probably null	Het
C130079G13Rik	A	G	3: 59,936,350	H155R	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Car10	T	C	11: 93,490,582	Y100H	probably damaging	Het
Ccdc81	T	A	7: 89,893,296	E124V	probably damaging	Het
Cd84	A	G	1: 171,872,927	T204A	probably benign	Het
Celf2	A	G	2: 6,604,176	S178P	probably damaging	Het
Chat	G	A	14: 32,409,019	T555M	probably damaging	Het
Chd6	A	G	2: 160,992,191	F917S	probably damaging	Het
Chrna2	C	A	14: 66,149,104	T233N	probably damaging	Het
Cnpy2	T	C	10: 128,326,185	V109A	probably benign	Het
Col4a1	T	C	8: 11,208,333		probably null	Het
Csmd1	C	T	8: 15,932,529	V2713M	possibly damaging	Het
Cuedc1	G	A	11: 88,183,405	R255Q	probably damaging	Het
Cxcl15	A	T	5: 90,798,038		probably benign	Het
Dach1	A	T	14: 97,901,329	H559Q	possibly damaging	Het
Dennd4c	C	T	4: 86,826,022	T1367M	probably damaging	Het
Depdc5	T	A	5: 32,945,028	Y365*	probably null	Het
Dmxl1	C	G	18: 49,891,467	S1736*	probably null	Het
Dnah7a	C	T	1: 53,497,126	R2586K	probably benign	Het
Dnajb8	T	C	6: 88,222,485	M1T	probably null	Het
Dync2h1	G	A	9: 7,122,692	P2088L	probably benign	Het
Eftud2	T	G	11: 102,844,222	H617P	probably damaging	Het
Ephb1	A	G	9: 101,995,980		probably benign	Het
Fam184a	G	T	10: 53,698,879	H155Q	probably benign	Het
Ganc	G	T	2: 120,448,401	E700*	probably null	Het
Gm10912	A	G	2: 104,066,945		probably benign	Het
Gm9047	G	T	6: 29,478,170		probably benign	Het
Haus5	A	T	7: 30,659,067	I294N	probably damaging	Het
Hmgcr	G	T	13: 96,660,143		probably null	Het
Hr	T	A	14: 70,561,912	C641*	probably null	Het
Itga10	A	G	3: 96,658,174	N1038S	probably damaging	Het
Itgb1bp1	T	G	12: 21,271,435	Y172S	probably damaging	Het
Kprp	T	C	3: 92,824,723	N340S	probably damaging	Het
Kremen1	A	G	11: 5,215,447	I41T	probably damaging	Het
Krt6b	A	G	15: 101,677,607		probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Ldhd	A	G	8: 111,629,677	Y86H	probably benign	Het
Lilra6	A	T	7: 3,912,785	I76N	possibly damaging	Het
Mak	T	C	13: 41,046,267	T299A	probably benign	Het
Med25	A	G	7: 44,885,078		probably null	Het
Mpg	A	T	11: 32,230,039	N189I	probably damaging	Het
Mroh8	A	G	2: 157,229,918	Y556H	probably damaging	Het
Myh8	T	A	11: 67,284,507	S294T	probably benign	Het
Myom1	T	A	17: 71,084,317	D842E	probably benign	Het
Nat2	C	T	8: 67,501,330	Q31*	probably null	Het
Nf1	T	A	11: 79,438,769	M653K	probably benign	Het
Nhs	C	A	X: 161,837,359	R1467I	probably damaging	Het
Npr2	A	G	4: 43,632,801	E206G	probably benign	Het
Nsd3	G	A	8: 25,678,716	G629D	possibly damaging	Het
Nwd1	G	A	8: 72,682,005	C831Y	probably damaging	Het
Olfr1094	A	G	2: 86,829,606	I285V	probably benign	Het
Olfr584	T	C	7: 103,085,851	I111T	probably damaging	Het
P2ry14	A	G	3: 59,116,028	S4P	possibly damaging	Het
Parp4	A	G	14: 56,635,715		probably benign	Het
Pclo	A	G	5: 14,678,285		probably benign	Het
Pclo	T	C	5: 14,679,398		probably benign	Het
Pcnt	A	T	10: 76,404,595	S1202T	possibly damaging	Het
Pfkfb4	A	G	9: 109,027,757	Y412C	probably damaging	Het
Pgm1	T	A	5: 64,110,555	V449D	probably damaging	Het
Poldip3	T	A	15: 83,138,235	D116V	probably damaging	Het
Pom121	G	T	5: 135,381,832	Q824K	unknown	Het
Prkdc	G	T	16: 15,831,282	G3707*	probably null	Het
Prr14l	T	C	5: 32,844,216		probably benign	Het
Ptbp2	T	G	3: 119,720,964	I405L	probably benign	Het
Rad21l	A	T	2: 151,649,069		probably benign	Het
Rbm6	G	A	9: 107,847,289	Q488*	probably null	Het
Rdh1	T	A	10: 127,764,783	M225K	probably benign	Het
Recql5	T	C	11: 115,928,383	D119G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo1	T	C	16: 73,013,125		probably null	Het
Samd12	G	A	15: 53,860,171	T42I	probably benign	Het
Scn10a	A	T	9: 119,613,700	M1494K	probably damaging	Het
Sec31a	G	A	5: 100,375,240	P864L	probably benign	Het
Senp2	T	C	16: 22,036,570	V344A	probably benign	Het
Serpina5	G	A	12: 104,103,362	D278N	probably benign	Het
Sh3tc1	A	T	5: 35,703,462	V1017D	probably damaging	Het
Sin3a	T	A	9: 57,096,895	Y310*	probably null	Het
Slc25a32	T	C	15: 39,097,545	T248A	probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	G	A	2: 62,286,862	V722M	probably damaging	Het
Slco1a4	A	G	6: 141,830,860		probably benign	Het
Smg6	T	A	11: 74,929,058	Y52N	probably damaging	Het
Sncb	T	G	13: 54,765,587	T33P	probably damaging	Het
Spef2	A	G	15: 9,583,984		probably null	Het
Sugp1	A	G	8: 70,059,363	E203G	probably damaging	Het
Suv39h2	A	T	2: 3,472,579	C105S	probably damaging	Het
Tlr1	A	T	5: 64,926,620	F205I	probably damaging	Het
Tnip1	A	T	11: 54,917,873	M496K	probably damaging	Het
Tnxb	G	A	17: 34,718,245	E2889K	probably damaging	Het
Trim30b	T	A	7: 104,365,803	H126L	possibly damaging	Het
Trpm7	A	T	2: 126,826,718	Y759*	probably null	Het
Ttc17	A	G	2: 94,323,120	I1000T	possibly damaging	Het
Ttc27	A	T	17: 74,718,715	N61I	probably benign	Het
Uba6	T	C	5: 86,112,750	Y990C	probably damaging	Het
Vav3	A	G	3: 109,664,440		probably benign	Het
Vmn2r55	C	T	7: 12,671,018	A153T	possibly damaging	Het
Wars2	A	G	3: 99,216,549	D242G	probably damaging	Het
Xylt2	G	A	11: 94,669,936	Q259*	probably null	Het
Zfp27	G	A	7: 29,894,522	P673S	probably damaging	Het
Zgrf1	T	C	3: 127,584,660	I1023T	possibly damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2203:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
R9505:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R9636:Dicer1	UTSW	12	104722147	nonsense	probably null
R9682:Dicer1	UTSW	12	104706225	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- TTCATCATGGCAGGCATCGTGGAC -3'
(R):5'- TCCCTGAACATGCTGCACATCAAG -3'

Sequencing Primer
(F):5'- CGTTCCCATCAAGGTACGTA -3'
(R):5'- AAGGTGCTACTAGACCCTCCTTAG -3'

Posted On

2013-06-11