Incidental Mutation 'R0511:Chrna2'
ID 46958
Institutional Source Beutler Lab
Gene Symbol Chrna2
Ensembl Gene ENSMUSG00000022041
Gene Name cholinergic receptor nicotinic alpha 2 subunit
Synonyms Acra-2, Acra2
MMRRC Submission 038705-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0511 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 66372488-66390397 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 66386553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 233 (T233N)
Ref Sequence ENSEMBL: ENSMUSP00000145896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730] [ENSMUST00000206455]
AlphaFold Q91X60
Predicted Effect probably damaging
Transcript: ENSMUST00000022620
AA Change: T233N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041
AA Change: T233N

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022622
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111121
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136216
Predicted Effect probably benign
Transcript: ENSMUST00000154865
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178730
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206455
AA Change: T233N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6923 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels formed by a pentameric arrangement of alpha and beta subunits to create distinct muscle and neuronal receptors. Neuronal receptors are found throughout the peripheral and central nervous system where they are involved in fast synaptic transmission. This gene encodes an alpha subunit that is widely expressed in the brain. The proposed structure for nAChR subunits is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. Mutations in this gene cause autosomal dominant nocturnal frontal lobe epilepsy type 4. Single nucleotide polymorphisms (SNPs) in this gene have been associated with nicotine dependence. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A G 3: 59,843,771 (GRCm39) H155R possibly damaging Het
Abca13 G T 11: 9,244,559 (GRCm39) V2141L probably benign Het
Adam17 T C 12: 21,390,459 (GRCm39) probably benign Het
Adam3 A T 8: 25,185,331 (GRCm39) C456S probably damaging Het
Aldh4a1 G T 4: 139,369,882 (GRCm39) probably benign Het
Anapc4 A G 5: 52,999,359 (GRCm39) probably benign Het
Ank3 A T 10: 69,718,198 (GRCm39) Q483L probably damaging Het
Ankle2 A G 5: 110,389,925 (GRCm39) probably benign Het
Ankrd13b T A 11: 77,364,114 (GRCm39) T150S possibly damaging Het
Apeh A G 9: 107,964,254 (GRCm39) M524T probably benign Het
Arl14epl T A 18: 47,059,484 (GRCm39) probably null Het
Atg2a T C 19: 6,302,569 (GRCm39) F964S possibly damaging Het
Atg2b C T 12: 105,583,412 (GRCm39) V2050M probably damaging Het
Atp2b4 A T 1: 133,659,956 (GRCm39) probably benign Het
Bbof1 T A 12: 84,477,045 (GRCm39) S512T probably benign Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Car10 T C 11: 93,381,408 (GRCm39) Y100H probably damaging Het
Ccdc81 T A 7: 89,542,504 (GRCm39) E124V probably damaging Het
Cd84 A G 1: 171,700,494 (GRCm39) T204A probably benign Het
Celf2 A G 2: 6,608,987 (GRCm39) S178P probably damaging Het
Chat G A 14: 32,130,976 (GRCm39) T555M probably damaging Het
Chd6 A G 2: 160,834,111 (GRCm39) F917S probably damaging Het
Cnpy2 T C 10: 128,162,054 (GRCm39) V109A probably benign Het
Col4a1 T C 8: 11,258,333 (GRCm39) probably null Het
Csmd1 C T 8: 15,982,529 (GRCm39) V2713M possibly damaging Het
Cuedc1 G A 11: 88,074,231 (GRCm39) R255Q probably damaging Het
Cxcl15 A T 5: 90,945,897 (GRCm39) probably benign Het
Dach1 A T 14: 98,138,765 (GRCm39) H559Q possibly damaging Het
Dele1 T C 18: 38,387,124 (GRCm39) probably null Het
Dennd4c C T 4: 86,744,259 (GRCm39) T1367M probably damaging Het
Depdc5 T A 5: 33,102,372 (GRCm39) Y365* probably null Het
Dicer1 T C 12: 104,669,100 (GRCm39) Y1194C possibly damaging Het
Dmxl1 C G 18: 50,024,534 (GRCm39) S1736* probably null Het
Dnah7a C T 1: 53,536,285 (GRCm39) R2586K probably benign Het
Dnajb8 T C 6: 88,199,467 (GRCm39) M1T probably null Het
Dync2h1 G A 9: 7,122,692 (GRCm39) P2088L probably benign Het
Eftud2 T G 11: 102,735,048 (GRCm39) H617P probably damaging Het
Ephb1 A G 9: 101,873,179 (GRCm39) probably benign Het
Fam184a G T 10: 53,574,975 (GRCm39) H155Q probably benign Het
Firrm T C 1: 163,799,412 (GRCm39) probably null Het
Ganc G T 2: 120,278,882 (GRCm39) E700* probably null Het
Gm10912 A G 2: 103,897,290 (GRCm39) probably benign Het
Haus5 A T 7: 30,358,492 (GRCm39) I294N probably damaging Het
Hmgcr G T 13: 96,796,651 (GRCm39) probably null Het
Hr T A 14: 70,799,352 (GRCm39) C641* probably null Het
Itga10 A G 3: 96,565,490 (GRCm39) N1038S probably damaging Het
Itgb1bp1 T G 12: 21,321,436 (GRCm39) Y172S probably damaging Het
Kprp T C 3: 92,732,030 (GRCm39) N340S probably damaging Het
Kremen1 A G 11: 5,165,447 (GRCm39) I41T probably damaging Het
Krt6b A G 15: 101,586,042 (GRCm39) probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Ldhd A G 8: 112,356,309 (GRCm39) Y86H probably benign Het
Lilra6 A T 7: 3,915,784 (GRCm39) I76N possibly damaging Het
Mak T C 13: 41,199,743 (GRCm39) T299A probably benign Het
Med25 A G 7: 44,534,502 (GRCm39) probably null Het
Mpg A T 11: 32,180,039 (GRCm39) N189I probably damaging Het
Mroh8 A G 2: 157,071,838 (GRCm39) Y556H probably damaging Het
Myh8 T A 11: 67,175,333 (GRCm39) S294T probably benign Het
Myom1 T A 17: 71,391,312 (GRCm39) D842E probably benign Het
Myorg A G 4: 41,498,538 (GRCm39) F364S probably damaging Het
Nat2 C T 8: 67,953,982 (GRCm39) Q31* probably null Het
Nf1 T A 11: 79,329,595 (GRCm39) M653K probably benign Het
Nhs C A X: 160,620,355 (GRCm39) R1467I probably damaging Het
Npr2 A G 4: 43,632,801 (GRCm39) E206G probably benign Het
Nsd3 G A 8: 26,168,732 (GRCm39) G629D possibly damaging Het
Nwd1 G A 8: 73,408,633 (GRCm39) C831Y probably damaging Het
Or52r1c T C 7: 102,735,058 (GRCm39) I111T probably damaging Het
Or5t9 A G 2: 86,659,950 (GRCm39) I285V probably benign Het
P2ry14 A G 3: 59,023,449 (GRCm39) S4P possibly damaging Het
Parp4 A G 14: 56,873,172 (GRCm39) probably benign Het
Pate14 A T 9: 36,549,873 (GRCm39) probably null Het
Pclo A G 5: 14,728,299 (GRCm39) probably benign Het
Pclo T C 5: 14,729,412 (GRCm39) probably benign Het
Pcnt A T 10: 76,240,429 (GRCm39) S1202T possibly damaging Het
Pfkfb4 A G 9: 108,856,825 (GRCm39) Y412C probably damaging Het
Pgm2 T A 5: 64,267,898 (GRCm39) V449D probably damaging Het
Poldip3 T A 15: 83,022,436 (GRCm39) D116V probably damaging Het
Pom121 G T 5: 135,410,686 (GRCm39) Q824K unknown Het
Prkdc G T 16: 15,649,146 (GRCm39) G3707* probably null Het
Prr14l T C 5: 33,001,560 (GRCm39) probably benign Het
Ptbp2 T G 3: 119,514,613 (GRCm39) I405L probably benign Het
Rad21l A T 2: 151,490,989 (GRCm39) probably benign Het
Rbm6 G A 9: 107,724,488 (GRCm39) Q488* probably null Het
Rdh1 T A 10: 127,600,652 (GRCm39) M225K probably benign Het
Recql5 T C 11: 115,819,209 (GRCm39) D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo1 T C 16: 72,810,013 (GRCm39) probably null Het
Samd12 G A 15: 53,723,567 (GRCm39) T42I probably benign Het
Scn10a A T 9: 119,442,766 (GRCm39) M1494K probably damaging Het
Sec31a G A 5: 100,523,099 (GRCm39) P864L probably benign Het
Senp2 T C 16: 21,855,320 (GRCm39) V344A probably benign Het
Serpina5 G A 12: 104,069,621 (GRCm39) D278N probably benign Het
Sh3tc1 A T 5: 35,860,806 (GRCm39) V1017D probably damaging Het
Sin3a T A 9: 57,004,179 (GRCm39) Y310* probably null Het
Slc25a32 T C 15: 38,960,940 (GRCm39) T248A probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 G A 2: 62,117,206 (GRCm39) V722M probably damaging Het
Slco1a4 A G 6: 141,776,586 (GRCm39) probably benign Het
Smg6 T A 11: 74,819,884 (GRCm39) Y52N probably damaging Het
Sncb T G 13: 54,913,400 (GRCm39) T33P probably damaging Het
Spef2 A G 15: 9,584,070 (GRCm39) probably null Het
Spmip1 G T 6: 29,478,169 (GRCm39) probably benign Het
Sugp1 A G 8: 70,512,013 (GRCm39) E203G probably damaging Het
Suv39h2 A T 2: 3,473,616 (GRCm39) C105S probably damaging Het
Tlr1 A T 5: 65,083,963 (GRCm39) F205I probably damaging Het
Tnip1 A T 11: 54,808,699 (GRCm39) M496K probably damaging Het
Tnxb G A 17: 34,937,219 (GRCm39) E2889K probably damaging Het
Trim30b T A 7: 104,015,010 (GRCm39) H126L possibly damaging Het
Trpm7 A T 2: 126,668,638 (GRCm39) Y759* probably null Het
Ttc17 A G 2: 94,153,465 (GRCm39) I1000T possibly damaging Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Uba6 T C 5: 86,260,609 (GRCm39) Y990C probably damaging Het
Vav3 A G 3: 109,571,756 (GRCm39) probably benign Het
Vmn2r55 C T 7: 12,404,945 (GRCm39) A153T possibly damaging Het
Wars2 A G 3: 99,123,865 (GRCm39) D242G probably damaging Het
Xylt2 G A 11: 94,560,762 (GRCm39) Q259* probably null Het
Zfp27 G A 7: 29,593,947 (GRCm39) P673S probably damaging Het
Zgrf1 T C 3: 127,378,309 (GRCm39) I1023T possibly damaging Het
Other mutations in Chrna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Chrna2 APN 14 66,386,889 (GRCm39) missense probably benign 0.01
IGL03172:Chrna2 APN 14 66,379,688 (GRCm39) missense probably benign
IGL03268:Chrna2 APN 14 66,388,395 (GRCm39) splice site probably benign
IGL03344:Chrna2 APN 14 66,388,415 (GRCm39) missense probably damaging 0.99
intrepid UTSW 14 66,383,902 (GRCm39) missense probably damaging 1.00
PIT1430001:Chrna2 UTSW 14 66,387,186 (GRCm39) missense probably benign 0.01
R0631:Chrna2 UTSW 14 66,386,757 (GRCm39) missense probably benign 0.45
R1205:Chrna2 UTSW 14 66,380,812 (GRCm39) missense probably benign 0.00
R1485:Chrna2 UTSW 14 66,380,812 (GRCm39) missense probably benign 0.00
R1487:Chrna2 UTSW 14 66,380,812 (GRCm39) missense probably benign 0.00
R1513:Chrna2 UTSW 14 66,380,878 (GRCm39) missense probably benign 0.13
R2023:Chrna2 UTSW 14 66,379,677 (GRCm39) missense probably benign 0.25
R2094:Chrna2 UTSW 14 66,386,912 (GRCm39) missense possibly damaging 0.65
R2964:Chrna2 UTSW 14 66,386,817 (GRCm39) missense possibly damaging 0.82
R2966:Chrna2 UTSW 14 66,386,817 (GRCm39) missense possibly damaging 0.82
R3118:Chrna2 UTSW 14 66,388,442 (GRCm39) missense probably damaging 0.98
R3931:Chrna2 UTSW 14 66,387,216 (GRCm39) missense probably benign 0.26
R3979:Chrna2 UTSW 14 66,386,402 (GRCm39) missense probably damaging 1.00
R3983:Chrna2 UTSW 14 66,386,906 (GRCm39) missense probably benign 0.00
R4080:Chrna2 UTSW 14 66,380,873 (GRCm39) nonsense probably null
R4080:Chrna2 UTSW 14 66,380,866 (GRCm39) missense probably benign 0.12
R4508:Chrna2 UTSW 14 66,383,902 (GRCm39) missense probably damaging 1.00
R4661:Chrna2 UTSW 14 66,386,292 (GRCm39) missense probably damaging 1.00
R4726:Chrna2 UTSW 14 66,386,345 (GRCm39) missense possibly damaging 0.85
R5349:Chrna2 UTSW 14 66,380,956 (GRCm39) missense probably damaging 0.99
R5787:Chrna2 UTSW 14 66,386,457 (GRCm39) missense probably benign 0.16
R6967:Chrna2 UTSW 14 66,388,398 (GRCm39) critical splice acceptor site probably null
R7218:Chrna2 UTSW 14 66,381,320 (GRCm39) splice site probably null
R7274:Chrna2 UTSW 14 66,386,675 (GRCm39) missense probably benign 0.03
R7565:Chrna2 UTSW 14 66,388,484 (GRCm39) missense probably benign
R7965:Chrna2 UTSW 14 66,388,525 (GRCm39) makesense probably null
R8337:Chrna2 UTSW 14 66,387,017 (GRCm39) nonsense probably null
R8955:Chrna2 UTSW 14 66,379,681 (GRCm39) missense probably benign 0.43
R9017:Chrna2 UTSW 14 66,386,282 (GRCm39) missense probably benign 0.40
Z1176:Chrna2 UTSW 14 66,386,753 (GRCm39) missense probably damaging 1.00
Z1177:Chrna2 UTSW 14 66,388,476 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGACATACGACAAGGCCAAG -3'
(R):5'- AACGGTGGTGGACATTGAGCAC -3'

Sequencing Primer
(F):5'- CCAAGATCGACCTGGAGCAG -3'
(R):5'- TGAAGAGCAGGTACTCGCC -3'
Posted On 2013-06-11