Mutagenetix > Incidental Mutation

Incidental Mutation 'R0511:Spef2'

46961

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

038705-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R0511 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 9583984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160236]

AlphaFold

Q8C9J3

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:CH_2	5	102	3.1e-25	PFAM
low complexity region	106	115	N/A	INTRINSIC
low complexity region	137	148	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	602	789	8.8e-11	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1221	N/A	INTRINSIC
low complexity region	1264	1278	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
SCOP:d1rec__	1378	1530	3e-3	SMART
low complexity region	1605	1624	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000160236

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Meta Mutation Damage Score

0.9486

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (116/116)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,254,071		probably null	Het
A630095E13Rik	A	T	9: 36,638,577		probably null	Het
Abca13	G	T	11: 9,294,559	V2141L	probably benign	Het
Adam17	T	C	12: 21,340,458		probably benign	Het
Adam3	A	T	8: 24,695,315	C456S	probably damaging	Het
AI464131	A	G	4: 41,498,538	F364S	probably damaging	Het
Aldh4a1	G	T	4: 139,642,571		probably benign	Het
Anapc4	A	G	5: 52,842,017		probably benign	Het
Ank3	A	T	10: 69,882,368	Q483L	probably damaging	Het
Ankle2	A	G	5: 110,242,059		probably benign	Het
Ankrd13b	T	A	11: 77,473,288	T150S	possibly damaging	Het
Apeh	A	G	9: 108,087,055	M524T	probably benign	Het
Arl14epl	T	A	18: 46,926,417		probably null	Het
Atg2a	T	C	19: 6,252,539	F964S	possibly damaging	Het
Atg2b	C	T	12: 105,617,153	V2050M	probably damaging	Het
Atp2b4	A	T	1: 133,732,218		probably benign	Het
Bbof1	T	A	12: 84,430,271	S512T	probably benign	Het
BC055324	T	C	1: 163,971,843		probably null	Het
C130079G13Rik	A	G	3: 59,936,350	H155R	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Car10	T	C	11: 93,490,582	Y100H	probably damaging	Het
Ccdc81	T	A	7: 89,893,296	E124V	probably damaging	Het
Cd84	A	G	1: 171,872,927	T204A	probably benign	Het
Celf2	A	G	2: 6,604,176	S178P	probably damaging	Het
Chat	G	A	14: 32,409,019	T555M	probably damaging	Het
Chd6	A	G	2: 160,992,191	F917S	probably damaging	Het
Chrna2	C	A	14: 66,149,104	T233N	probably damaging	Het
Cnpy2	T	C	10: 128,326,185	V109A	probably benign	Het
Col4a1	T	C	8: 11,208,333		probably null	Het
Csmd1	C	T	8: 15,932,529	V2713M	possibly damaging	Het
Cuedc1	G	A	11: 88,183,405	R255Q	probably damaging	Het
Cxcl15	A	T	5: 90,798,038		probably benign	Het
Dach1	A	T	14: 97,901,329	H559Q	possibly damaging	Het
Dennd4c	C	T	4: 86,826,022	T1367M	probably damaging	Het
Depdc5	T	A	5: 32,945,028	Y365*	probably null	Het
Dicer1	T	C	12: 104,702,841	Y1194C	possibly damaging	Het
Dmxl1	C	G	18: 49,891,467	S1736*	probably null	Het
Dnah7a	C	T	1: 53,497,126	R2586K	probably benign	Het
Dnajb8	T	C	6: 88,222,485	M1T	probably null	Het
Dync2h1	G	A	9: 7,122,692	P2088L	probably benign	Het
Eftud2	T	G	11: 102,844,222	H617P	probably damaging	Het
Ephb1	A	G	9: 101,995,980		probably benign	Het
Fam184a	G	T	10: 53,698,879	H155Q	probably benign	Het
Ganc	G	T	2: 120,448,401	E700*	probably null	Het
Gm10912	A	G	2: 104,066,945		probably benign	Het
Gm9047	G	T	6: 29,478,170		probably benign	Het
Haus5	A	T	7: 30,659,067	I294N	probably damaging	Het
Hmgcr	G	T	13: 96,660,143		probably null	Het
Hr	T	A	14: 70,561,912	C641*	probably null	Het
Itga10	A	G	3: 96,658,174	N1038S	probably damaging	Het
Itgb1bp1	T	G	12: 21,271,435	Y172S	probably damaging	Het
Kprp	T	C	3: 92,824,723	N340S	probably damaging	Het
Kremen1	A	G	11: 5,215,447	I41T	probably damaging	Het
Krt6b	A	G	15: 101,677,607		probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Ldhd	A	G	8: 111,629,677	Y86H	probably benign	Het
Lilra6	A	T	7: 3,912,785	I76N	possibly damaging	Het
Mak	T	C	13: 41,046,267	T299A	probably benign	Het
Med25	A	G	7: 44,885,078		probably null	Het
Mpg	A	T	11: 32,230,039	N189I	probably damaging	Het
Mroh8	A	G	2: 157,229,918	Y556H	probably damaging	Het
Myh8	T	A	11: 67,284,507	S294T	probably benign	Het
Myom1	T	A	17: 71,084,317	D842E	probably benign	Het
Nat2	C	T	8: 67,501,330	Q31*	probably null	Het
Nf1	T	A	11: 79,438,769	M653K	probably benign	Het
Nhs	C	A	X: 161,837,359	R1467I	probably damaging	Het
Npr2	A	G	4: 43,632,801	E206G	probably benign	Het
Nsd3	G	A	8: 25,678,716	G629D	possibly damaging	Het
Nwd1	G	A	8: 72,682,005	C831Y	probably damaging	Het
Olfr1094	A	G	2: 86,829,606	I285V	probably benign	Het
Olfr584	T	C	7: 103,085,851	I111T	probably damaging	Het
P2ry14	A	G	3: 59,116,028	S4P	possibly damaging	Het
Parp4	A	G	14: 56,635,715		probably benign	Het
Pclo	A	G	5: 14,678,285		probably benign	Het
Pclo	T	C	5: 14,679,398		probably benign	Het
Pcnt	A	T	10: 76,404,595	S1202T	possibly damaging	Het
Pfkfb4	A	G	9: 109,027,757	Y412C	probably damaging	Het
Pgm1	T	A	5: 64,110,555	V449D	probably damaging	Het
Poldip3	T	A	15: 83,138,235	D116V	probably damaging	Het
Pom121	G	T	5: 135,381,832	Q824K	unknown	Het
Prkdc	G	T	16: 15,831,282	G3707*	probably null	Het
Prr14l	T	C	5: 32,844,216		probably benign	Het
Ptbp2	T	G	3: 119,720,964	I405L	probably benign	Het
Rad21l	A	T	2: 151,649,069		probably benign	Het
Rbm6	G	A	9: 107,847,289	Q488*	probably null	Het
Rdh1	T	A	10: 127,764,783	M225K	probably benign	Het
Recql5	T	C	11: 115,928,383	D119G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo1	T	C	16: 73,013,125		probably null	Het
Samd12	G	A	15: 53,860,171	T42I	probably benign	Het
Scn10a	A	T	9: 119,613,700	M1494K	probably damaging	Het
Sec31a	G	A	5: 100,375,240	P864L	probably benign	Het
Senp2	T	C	16: 22,036,570	V344A	probably benign	Het
Serpina5	G	A	12: 104,103,362	D278N	probably benign	Het
Sh3tc1	A	T	5: 35,703,462	V1017D	probably damaging	Het
Sin3a	T	A	9: 57,096,895	Y310*	probably null	Het
Slc25a32	T	C	15: 39,097,545	T248A	probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	G	A	2: 62,286,862	V722M	probably damaging	Het
Slco1a4	A	G	6: 141,830,860		probably benign	Het
Smg6	T	A	11: 74,929,058	Y52N	probably damaging	Het
Sncb	T	G	13: 54,765,587	T33P	probably damaging	Het
Sugp1	A	G	8: 70,059,363	E203G	probably damaging	Het
Suv39h2	A	T	2: 3,472,579	C105S	probably damaging	Het
Tlr1	A	T	5: 64,926,620	F205I	probably damaging	Het
Tnip1	A	T	11: 54,917,873	M496K	probably damaging	Het
Tnxb	G	A	17: 34,718,245	E2889K	probably damaging	Het
Trim30b	T	A	7: 104,365,803	H126L	possibly damaging	Het
Trpm7	A	T	2: 126,826,718	Y759*	probably null	Het
Ttc17	A	G	2: 94,323,120	I1000T	possibly damaging	Het
Ttc27	A	T	17: 74,718,715	N61I	probably benign	Het
Uba6	T	C	5: 86,112,750	Y990C	probably damaging	Het
Vav3	A	G	3: 109,664,440		probably benign	Het
Vmn2r55	C	T	7: 12,671,018	A153T	possibly damaging	Het
Wars2	A	G	3: 99,216,549	D242G	probably damaging	Het
Xylt2	G	A	11: 94,669,936	Q259*	probably null	Het
Zfp27	G	A	7: 29,894,522	P673S	probably damaging	Het
Zgrf1	T	C	3: 127,584,660	I1023T	possibly damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	splice site	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9601085	missense	unknown
R8105:Spef2	UTSW	15	9682662	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9601512	missense	unknown
R8296:Spef2	UTSW	15	9727543	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9676529	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9612557	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9600679	intron	probably benign
R8691:Spef2	UTSW	15	9601919	nonsense	probably null
R8751:Spef2	UTSW	15	9729637	nonsense	probably null
R8847:Spef2	UTSW	15	9668827	missense	probably benign
R8864:Spef2	UTSW	15	9599747	missense	unknown
R8868:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R8916:Spef2	UTSW	15	9725180	nonsense	probably null
R8935:Spef2	UTSW	15	9607350	missense	probably damaging	0.98
R8961:Spef2	UTSW	15	9647328	missense	possibly damaging	0.92
R8978:Spef2	UTSW	15	9725177	missense	possibly damaging	0.81
R9062:Spef2	UTSW	15	9601631	missense	unknown
R9076:Spef2	UTSW	15	9653005	missense	probably benign	0.13
R9149:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R9162:Spef2	UTSW	15	9601931	missense	unknown
R9216:Spef2	UTSW	15	9647525	missense	probably damaging	1.00
R9240:Spef2	UTSW	15	9578315	nonsense	probably null
R9278:Spef2	UTSW	15	9727409	critical splice donor site	probably null
R9341:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9343:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9389:Spef2	UTSW	15	9725221	missense	probably damaging	0.96
R9476:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9510:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9537:Spef2	UTSW	15	9601799	missense	unknown
R9575:Spef2	UTSW	15	9596586	missense	probably damaging	1.00
R9597:Spef2	UTSW	15	9599811	missense	unknown
R9765:Spef2	UTSW	15	9601859	missense	unknown
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCAATTGGCTCCAGGTTCC -3'
(R):5'- GCATCTCCATTGCTCGAAGCATCTC -3'

Sequencing Primer
(F):5'- CTCCAGGTTCCTGGCAC -3'
(R):5'- CCACTGTGAGTCCCATTGAG -3'

Posted On

2013-06-11