Incidental Mutation 'R0511:Robo1'
ID46969
Institutional Source Beutler Lab
Gene Symbol Robo1
Ensembl Gene ENSMUSG00000022883
Gene Nameroundabout guidance receptor 1
SynonymsDUTT1
MMRRC Submission 038705-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location72308306-73046095 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 73013125 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023600]
Predicted Effect probably null
Transcript: ENSMUST00000023600
SMART Domains Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883

DomainStartEndE-ValueType
IGc2 41 115 3.15e-10 SMART
IGc2 143 208 2.52e-9 SMART
IGc2 235 298 3.85e-14 SMART
IGv 328 391 3.71e-7 SMART
IGc2 428 493 2.46e-12 SMART
FN3 522 604 3.17e-13 SMART
FN3 634 721 1.66e0 SMART
FN3 736 822 4.28e-10 SMART
low complexity region 1108 1125 N/A INTRINSIC
low complexity region 1148 1157 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1249 1269 N/A INTRINSIC
low complexity region 1282 1298 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1362 1380 N/A INTRINSIC
low complexity region 1442 1449 N/A INTRINSIC
low complexity region 1563 1576 N/A INTRINSIC
low complexity region 1602 1611 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000232205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232432
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Csmd1 C T 8: 15,932,529 V2713M possibly damaging Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Robo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Robo1 APN 16 73004665 missense probably benign 0.00
IGL01937:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL01945:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL02151:Robo1 APN 16 72989616 missense probably benign 0.00
IGL02232:Robo1 APN 16 72971984 missense possibly damaging 0.59
IGL02282:Robo1 APN 16 72742138 missense probably damaging 1.00
IGL02590:Robo1 APN 16 73043132 missense probably benign 0.06
IGL02874:Robo1 APN 16 73012918 missense probably damaging 0.96
IGL02974:Robo1 APN 16 73006862 missense probably benign 0.09
IGL03233:Robo1 APN 16 72970193 missense probably damaging 0.99
PIT4378001:Robo1 UTSW 16 73004535 missense probably damaging 1.00
R0079:Robo1 UTSW 16 72933342 splice site probably benign
R0254:Robo1 UTSW 16 72664170 missense probably benign 0.00
R0366:Robo1 UTSW 16 72742245 missense possibly damaging 0.52
R0410:Robo1 UTSW 16 72971984 missense possibly damaging 0.59
R0563:Robo1 UTSW 16 72972286 missense probably benign 0.01
R0637:Robo1 UTSW 16 73001951 missense probably benign 0.29
R1239:Robo1 UTSW 16 73024542 splice site probably null
R1773:Robo1 UTSW 16 73004511 missense probably benign 0.00
R1777:Robo1 UTSW 16 73004667 missense probably benign
R1901:Robo1 UTSW 16 72960204 missense probably null 1.00
R1902:Robo1 UTSW 16 72960204 missense probably null 1.00
R1903:Robo1 UTSW 16 72960204 missense probably null 1.00
R1996:Robo1 UTSW 16 72970179 missense probably benign 0.40
R2040:Robo1 UTSW 16 72933742 missense probably damaging 1.00
R2266:Robo1 UTSW 16 72978772 missense probably benign
R2269:Robo1 UTSW 16 72978772 missense probably benign
R2433:Robo1 UTSW 16 72970239 missense probably benign 0.01
R3084:Robo1 UTSW 16 73004737 missense probably benign 0.02
R3085:Robo1 UTSW 16 73002010 missense possibly damaging 0.81
R3150:Robo1 UTSW 16 72970269 missense possibly damaging 0.57
R3418:Robo1 UTSW 16 73035917 missense probably benign 0.00
R3610:Robo1 UTSW 16 72983770 missense probably benign 0.00
R3940:Robo1 UTSW 16 73009743 missense probably benign
R3953:Robo1 UTSW 16 73024338 missense probably damaging 1.00
R4692:Robo1 UTSW 16 72960202 missense probably damaging 1.00
R4726:Robo1 UTSW 16 72972043 missense probably damaging 1.00
R4814:Robo1 UTSW 16 72972035 missense probably benign 0.11
R4884:Robo1 UTSW 16 72904751 missense probably damaging 1.00
R4992:Robo1 UTSW 16 72979868 missense probably damaging 0.98
R5150:Robo1 UTSW 16 72972304 missense possibly damaging 0.79
R5183:Robo1 UTSW 16 72742150 missense probably benign 0.03
R5360:Robo1 UTSW 16 72935777 missense probably damaging 0.96
R5629:Robo1 UTSW 16 72983710 missense probably benign 0.33
R5804:Robo1 UTSW 16 73043189 critical splice donor site probably null
R6107:Robo1 UTSW 16 72983829 missense probably benign 0.00
R6127:Robo1 UTSW 16 73013068 missense probably benign
R6128:Robo1 UTSW 16 73013068 missense probably benign
R6129:Robo1 UTSW 16 73013068 missense probably benign
R6191:Robo1 UTSW 16 72933808 missense probably benign 0.00
R6357:Robo1 UTSW 16 72970302 missense probably benign 0.00
R6408:Robo1 UTSW 16 72972046 missense probably benign 0.00
R6516:Robo1 UTSW 16 73024353 missense probably benign 0.14
R6600:Robo1 UTSW 16 72989655 missense probably damaging 1.00
R6802:Robo1 UTSW 16 72933313 missense probably benign 0.17
R7105:Robo1 UTSW 16 72742161 missense probably damaging 1.00
R7189:Robo1 UTSW 16 72960151 nonsense probably null
R7290:Robo1 UTSW 16 73004520 missense probably benign 0.03
R7296:Robo1 UTSW 16 72989631 nonsense probably null
R7576:Robo1 UTSW 16 72970181 missense probably damaging 0.99
R7605:Robo1 UTSW 16 73024301 missense probably benign 0.14
R7607:Robo1 UTSW 16 72563738 missense
R7636:Robo1 UTSW 16 72563727 missense
R7857:Robo1 UTSW 16 72970211 missense probably damaging 1.00
R7940:Robo1 UTSW 16 72970211 missense probably damaging 1.00
R7997:Robo1 UTSW 16 72904693 missense not run
Z1176:Robo1 UTSW 16 72977800 missense not run
Predicted Primers PCR Primer
(F):5'- AAGAAATGCCCTGTCCAGTGCCAC -3'
(R):5'- AGTTCACGGGCTTCGAGAGTCAAC -3'

Sequencing Primer
(F):5'- TATTTGCAACAGGATGAATTAGAGG -3'
(R):5'- GCTTCGAGAGTCAACAGTATTAG -3'
Posted On2013-06-11