Mutagenetix > Incidental Mutation

Incidental Mutation 'R0511:Tnxb'

46970

Institutional Source

Beutler Lab

Gene Symbol

Tnxb

Ensembl Gene

ENSMUSG00000033327

Gene Name

tenascin XB

Synonyms

Tnx, TN-MHC

MMRRC Submission

038705-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0511 (G1)

Quality Score

191

Status

Validated

Chromosome

Chromosomal Location

34670535-34719815 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34718245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 2889 (E2889K)

Ref Sequence

ENSEMBL: ENSMUSP00000127487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087399
AA Change: E3769K

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: E3769K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
low complexity region	92	103	N/A	INTRINSIC
EGF	173	201	1.59e1	SMART
EGF	204	232	7.41e0	SMART
EGF	235	263	2.64e1	SMART
EGF	266	294	2.64e1	SMART
EGF	297	325	9.13e0	SMART
EGF	328	356	2.07e1	SMART
EGF_like	359	387	3.16e1	SMART
EGF_like	390	418	4.64e1	SMART
EGF_like	421	449	3.29e1	SMART
EGF_like	452	480	7.09e1	SMART
EGF	483	511	1.15e1	SMART
EGF	514	542	1.91e1	SMART
EGF_like	545	573	4.11e1	SMART
EGF	576	604	7.95e0	SMART
EGF	607	635	1.23e1	SMART
EGF_like	638	666	4.93e1	SMART
EGF_like	674	702	5.24e1	SMART
EGF	705	733	2.29e1	SMART
FN3	736	816	4.12e-3	SMART
FN3	827	904	1.21e-9	SMART
FN3	1047	1126	3.97e-5	SMART
FN3	1142	1223	3.62e-8	SMART
low complexity region	1230	1241	N/A	INTRINSIC
FN3	1242	1320	2.31e-6	SMART
FN3	1351	1431	8.77e-7	SMART
FN3	1460	1539	3.01e-5	SMART
FN3	1556	1636	2.76e-4	SMART
FN3	1657	1736	5.78e-7	SMART
FN3	1752	1832	4.7e-7	SMART
FN3	1851	1929	1.95e-4	SMART
FN3	1955	2034	4.56e-5	SMART
FN3	2066	2145	2.23e-8	SMART
FN3	2164	2244	7.75e-8	SMART
FN3	2279	2358	8.5e-5	SMART
FN3	2387	2467	2.94e-8	SMART
FN3	2501	2580	1.7e-4	SMART
low complexity region	2588	2598	N/A	INTRINSIC
FN3	2607	2687	6.75e-8	SMART
FN3	2716	2795	7.4e-5	SMART
FN3	2822	2902	1.35e-7	SMART
FN3	2931	3010	5.61e-5	SMART
FN3	3026	3106	6.01e-5	SMART
FN3	3120	3199	6.45e-5	SMART
FN3	3214	3293	9.54e-8	SMART
FN3	3316	3396	2.81e-5	SMART
FN3	3416	3502	1.98e-5	SMART
FN3	3518	3596	5.65e-10	SMART
FN3	3607	3682	7.63e-7	SMART
FN3	3695	3770	6.54e-6	SMART
FBG	3787	3997	8.88e-125	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168533
AA Change: E2889K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327
AA Change: E2889K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
low complexity region	92	103	N/A	INTRINSIC
EGF	173	201	1.59e1	SMART
EGF	204	232	7.41e0	SMART
EGF	235	263	2.64e1	SMART
EGF	266	294	2.64e1	SMART
EGF	297	325	9.13e0	SMART
EGF	328	356	2.07e1	SMART
EGF_like	359	387	3.16e1	SMART
EGF_like	390	418	4.64e1	SMART
EGF_like	421	449	3.29e1	SMART
EGF_like	452	480	7.09e1	SMART
EGF	483	511	1.15e1	SMART
EGF	514	542	1.91e1	SMART
EGF_like	545	573	4.11e1	SMART
EGF	576	604	7.95e0	SMART
EGF	607	635	1.23e1	SMART
EGF_like	638	666	4.93e1	SMART
EGF_like	674	702	5.24e1	SMART
EGF	705	733	2.29e1	SMART
FN3	736	816	4.12e-3	SMART
FN3	827	904	1.21e-9	SMART
FN3	924	1003	3.97e-5	SMART
FN3	1019	1100	3.62e-8	SMART
low complexity region	1107	1118	N/A	INTRINSIC
FN3	1119	1197	2.31e-6	SMART
FN3	1228	1308	8.77e-7	SMART
FN3	1337	1416	3.01e-5	SMART
FN3	1433	1513	2.76e-4	SMART
FN3	1534	1613	5.78e-7	SMART
FN3	1629	1709	4.7e-7	SMART
FN3	1728	1806	1.95e-4	SMART
FN3	1832	1911	4.56e-5	SMART
FN3	1943	2022	2.23e-8	SMART
FN3	2051	2130	5.61e-5	SMART
FN3	2146	2226	6.01e-5	SMART
FN3	2240	2319	6.45e-5	SMART
FN3	2334	2413	9.54e-8	SMART
FN3	2436	2516	2.81e-5	SMART
FN3	2536	2622	1.98e-5	SMART
FN3	2638	2716	5.65e-10	SMART
FN3	2727	2802	7.63e-7	SMART
FN3	2815	2890	6.54e-6	SMART
FBG	2907	3117	8.88e-125	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172970

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (116/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,254,071		probably null	Het
A630095E13Rik	A	T	9: 36,638,577		probably null	Het
Abca13	G	T	11: 9,294,559	V2141L	probably benign	Het
Adam17	T	C	12: 21,340,458		probably benign	Het
Adam3	A	T	8: 24,695,315	C456S	probably damaging	Het
AI464131	A	G	4: 41,498,538	F364S	probably damaging	Het
Aldh4a1	G	T	4: 139,642,571		probably benign	Het
Anapc4	A	G	5: 52,842,017		probably benign	Het
Ank3	A	T	10: 69,882,368	Q483L	probably damaging	Het
Ankle2	A	G	5: 110,242,059		probably benign	Het
Ankrd13b	T	A	11: 77,473,288	T150S	possibly damaging	Het
Apeh	A	G	9: 108,087,055	M524T	probably benign	Het
Arl14epl	T	A	18: 46,926,417		probably null	Het
Atg2a	T	C	19: 6,252,539	F964S	possibly damaging	Het
Atg2b	C	T	12: 105,617,153	V2050M	probably damaging	Het
Atp2b4	A	T	1: 133,732,218		probably benign	Het
Bbof1	T	A	12: 84,430,271	S512T	probably benign	Het
BC055324	T	C	1: 163,971,843		probably null	Het
C130079G13Rik	A	G	3: 59,936,350	H155R	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Car10	T	C	11: 93,490,582	Y100H	probably damaging	Het
Ccdc81	T	A	7: 89,893,296	E124V	probably damaging	Het
Cd84	A	G	1: 171,872,927	T204A	probably benign	Het
Celf2	A	G	2: 6,604,176	S178P	probably damaging	Het
Chat	G	A	14: 32,409,019	T555M	probably damaging	Het
Chd6	A	G	2: 160,992,191	F917S	probably damaging	Het
Chrna2	C	A	14: 66,149,104	T233N	probably damaging	Het
Cnpy2	T	C	10: 128,326,185	V109A	probably benign	Het
Col4a1	T	C	8: 11,208,333		probably null	Het
Csmd1	C	T	8: 15,932,529	V2713M	possibly damaging	Het
Cuedc1	G	A	11: 88,183,405	R255Q	probably damaging	Het
Cxcl15	A	T	5: 90,798,038		probably benign	Het
Dach1	A	T	14: 97,901,329	H559Q	possibly damaging	Het
Dennd4c	C	T	4: 86,826,022	T1367M	probably damaging	Het
Depdc5	T	A	5: 32,945,028	Y365*	probably null	Het
Dicer1	T	C	12: 104,702,841	Y1194C	possibly damaging	Het
Dmxl1	C	G	18: 49,891,467	S1736*	probably null	Het
Dnah7a	C	T	1: 53,497,126	R2586K	probably benign	Het
Dnajb8	T	C	6: 88,222,485	M1T	probably null	Het
Dync2h1	G	A	9: 7,122,692	P2088L	probably benign	Het
Eftud2	T	G	11: 102,844,222	H617P	probably damaging	Het
Ephb1	A	G	9: 101,995,980		probably benign	Het
Fam184a	G	T	10: 53,698,879	H155Q	probably benign	Het
Ganc	G	T	2: 120,448,401	E700*	probably null	Het
Gm10912	A	G	2: 104,066,945		probably benign	Het
Gm9047	G	T	6: 29,478,170		probably benign	Het
Haus5	A	T	7: 30,659,067	I294N	probably damaging	Het
Hmgcr	G	T	13: 96,660,143		probably null	Het
Hr	T	A	14: 70,561,912	C641*	probably null	Het
Itga10	A	G	3: 96,658,174	N1038S	probably damaging	Het
Itgb1bp1	T	G	12: 21,271,435	Y172S	probably damaging	Het
Kprp	T	C	3: 92,824,723	N340S	probably damaging	Het
Kremen1	A	G	11: 5,215,447	I41T	probably damaging	Het
Krt6b	A	G	15: 101,677,607		probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Ldhd	A	G	8: 111,629,677	Y86H	probably benign	Het
Lilra6	A	T	7: 3,912,785	I76N	possibly damaging	Het
Mak	T	C	13: 41,046,267	T299A	probably benign	Het
Med25	A	G	7: 44,885,078		probably null	Het
Mpg	A	T	11: 32,230,039	N189I	probably damaging	Het
Mroh8	A	G	2: 157,229,918	Y556H	probably damaging	Het
Myh8	T	A	11: 67,284,507	S294T	probably benign	Het
Myom1	T	A	17: 71,084,317	D842E	probably benign	Het
Nat2	C	T	8: 67,501,330	Q31*	probably null	Het
Nf1	T	A	11: 79,438,769	M653K	probably benign	Het
Nhs	C	A	X: 161,837,359	R1467I	probably damaging	Het
Npr2	A	G	4: 43,632,801	E206G	probably benign	Het
Nsd3	G	A	8: 25,678,716	G629D	possibly damaging	Het
Nwd1	G	A	8: 72,682,005	C831Y	probably damaging	Het
Olfr1094	A	G	2: 86,829,606	I285V	probably benign	Het
Olfr584	T	C	7: 103,085,851	I111T	probably damaging	Het
P2ry14	A	G	3: 59,116,028	S4P	possibly damaging	Het
Parp4	A	G	14: 56,635,715		probably benign	Het
Pclo	A	G	5: 14,678,285		probably benign	Het
Pclo	T	C	5: 14,679,398		probably benign	Het
Pcnt	A	T	10: 76,404,595	S1202T	possibly damaging	Het
Pfkfb4	A	G	9: 109,027,757	Y412C	probably damaging	Het
Pgm1	T	A	5: 64,110,555	V449D	probably damaging	Het
Poldip3	T	A	15: 83,138,235	D116V	probably damaging	Het
Pom121	G	T	5: 135,381,832	Q824K	unknown	Het
Prkdc	G	T	16: 15,831,282	G3707*	probably null	Het
Prr14l	T	C	5: 32,844,216		probably benign	Het
Ptbp2	T	G	3: 119,720,964	I405L	probably benign	Het
Rad21l	A	T	2: 151,649,069		probably benign	Het
Rbm6	G	A	9: 107,847,289	Q488*	probably null	Het
Rdh1	T	A	10: 127,764,783	M225K	probably benign	Het
Recql5	T	C	11: 115,928,383	D119G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Robo1	T	C	16: 73,013,125		probably null	Het
Samd12	G	A	15: 53,860,171	T42I	probably benign	Het
Scn10a	A	T	9: 119,613,700	M1494K	probably damaging	Het
Sec31a	G	A	5: 100,375,240	P864L	probably benign	Het
Senp2	T	C	16: 22,036,570	V344A	probably benign	Het
Serpina5	G	A	12: 104,103,362	D278N	probably benign	Het
Sh3tc1	A	T	5: 35,703,462	V1017D	probably damaging	Het
Sin3a	T	A	9: 57,096,895	Y310*	probably null	Het
Slc25a32	T	C	15: 39,097,545	T248A	probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	G	A	2: 62,286,862	V722M	probably damaging	Het
Slco1a4	A	G	6: 141,830,860		probably benign	Het
Smg6	T	A	11: 74,929,058	Y52N	probably damaging	Het
Sncb	T	G	13: 54,765,587	T33P	probably damaging	Het
Spef2	A	G	15: 9,583,984		probably null	Het
Sugp1	A	G	8: 70,059,363	E203G	probably damaging	Het
Suv39h2	A	T	2: 3,472,579	C105S	probably damaging	Het
Tlr1	A	T	5: 64,926,620	F205I	probably damaging	Het
Tnip1	A	T	11: 54,917,873	M496K	probably damaging	Het
Trim30b	T	A	7: 104,365,803	H126L	possibly damaging	Het
Trpm7	A	T	2: 126,826,718	Y759*	probably null	Het
Ttc17	A	G	2: 94,323,120	I1000T	possibly damaging	Het
Ttc27	A	T	17: 74,718,715	N61I	probably benign	Het
Uba6	T	C	5: 86,112,750	Y990C	probably damaging	Het
Vav3	A	G	3: 109,664,440		probably benign	Het
Vmn2r55	C	T	7: 12,671,018	A153T	possibly damaging	Het
Wars2	A	G	3: 99,216,549	D242G	probably damaging	Het
Xylt2	G	A	11: 94,669,936	Q259*	probably null	Het
Zfp27	G	A	7: 29,894,522	P673S	probably damaging	Het
Zgrf1	T	C	3: 127,584,660	I1023T	possibly damaging	Het

Other mutations in Tnxb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Tnxb	APN	17	34685629	missense	probably damaging	1.00
IGL00424:Tnxb	APN	17	34714692	missense	probably damaging	1.00
IGL00486:Tnxb	APN	17	34692382	missense	probably damaging	1.00
IGL00952:Tnxb	APN	17	34713128	missense	probably damaging	1.00
IGL00974:Tnxb	APN	17	34718733	critical splice donor site	probably null
IGL01017:Tnxb	APN	17	34693808	missense	probably damaging	0.98
IGL01082:Tnxb	APN	17	34714610	missense	probably damaging	0.97
IGL01397:Tnxb	APN	17	34714673	missense	probably damaging	0.99
IGL01473:Tnxb	APN	17	34685701	missense	probably damaging	0.99
IGL01642:Tnxb	APN	17	34718514	missense	probably damaging	1.00
IGL01774:Tnxb	APN	17	34688839	missense	probably damaging	1.00
IGL01971:Tnxb	APN	17	34672297	missense	probably damaging	1.00
IGL02016:Tnxb	APN	17	34672275	missense	probably damaging	0.98
IGL02160:Tnxb	APN	17	34714745	missense	probably benign	0.01
IGL02473:Tnxb	APN	17	34717762	missense	probably damaging	1.00
IGL02666:Tnxb	APN	17	34684939	missense	probably benign	0.20
IGL02831:Tnxb	APN	17	34703571	missense	possibly damaging	0.93
IGL02838:Tnxb	APN	17	34689632	missense	possibly damaging	0.74
IGL02965:Tnxb	APN	17	34709654	missense	possibly damaging	0.93
IGL03155:Tnxb	APN	17	34713595	missense	probably damaging	1.00
IGL03194:Tnxb	APN	17	34695947	nonsense	probably null
IGL03215:Tnxb	APN	17	34692525	missense	possibly damaging	0.66
IGL03256:Tnxb	APN	17	34688720	missense	probably damaging	1.00
BB008:Tnxb	UTSW	17	34688698	missense	probably damaging	1.00
BB018:Tnxb	UTSW	17	34688698	missense	probably damaging	1.00
E0370:Tnxb	UTSW	17	34678943	missense	probably damaging	1.00
R0006:Tnxb	UTSW	17	34682292	missense	probably benign	0.07
R0049:Tnxb	UTSW	17	34709568	missense	possibly damaging	0.93
R0050:Tnxb	UTSW	17	34673325	missense	probably damaging	1.00
R0233:Tnxb	UTSW	17	34699033	missense	probably benign	0.32
R0233:Tnxb	UTSW	17	34699033	missense	probably benign	0.32
R0311:Tnxb	UTSW	17	34716984	missense	probably damaging	0.97
R0326:Tnxb	UTSW	17	34698179	missense	probably benign	0.32
R0387:Tnxb	UTSW	17	34683574	missense	probably benign	0.30
R0396:Tnxb	UTSW	17	34671733	missense	probably damaging	1.00
R0540:Tnxb	UTSW	17	34671918	missense	probably damaging	1.00
R0563:Tnxb	UTSW	17	34716947	missense	probably benign	0.05
R0575:Tnxb	UTSW	17	34717206	missense	possibly damaging	0.91
R0586:Tnxb	UTSW	17	34672144	missense	probably damaging	1.00
R0607:Tnxb	UTSW	17	34671918	missense	probably damaging	1.00
R0622:Tnxb	UTSW	17	34718729	missense	probably damaging	1.00
R0624:Tnxb	UTSW	17	34683548	missense	probably damaging	1.00
R0709:Tnxb	UTSW	17	34689354	missense	probably damaging	1.00
R0898:Tnxb	UTSW	17	34670745	missense	probably damaging	1.00
R0970:Tnxb	UTSW	17	34698943	missense	possibly damaging	0.85
R0972:Tnxb	UTSW	17	34685143	missense	probably damaging	1.00
R1118:Tnxb	UTSW	17	34685043	missense	probably damaging	1.00
R1119:Tnxb	UTSW	17	34685043	missense	probably damaging	1.00
R1226:Tnxb	UTSW	17	34688929	missense	probably damaging	1.00
R1296:Tnxb	UTSW	17	34671577	missense	probably damaging	1.00
R1297:Tnxb	UTSW	17	34710166	missense	probably damaging	0.96
R1349:Tnxb	UTSW	17	34710293	missense	possibly damaging	0.67
R1356:Tnxb	UTSW	17	34695472	missense	possibly damaging	0.53
R1372:Tnxb	UTSW	17	34710293	missense	possibly damaging	0.67
R1521:Tnxb	UTSW	17	34711503	missense	probably damaging	1.00
R1522:Tnxb	UTSW	17	34718638	missense	probably damaging	1.00
R1532:Tnxb	UTSW	17	34710830	missense	probably damaging	1.00
R1735:Tnxb	UTSW	17	34717970	missense	probably damaging	1.00
R1778:Tnxb	UTSW	17	34683574	missense	probably benign	0.30
R1802:Tnxb	UTSW	17	34703889	missense	probably damaging	0.98
R1824:Tnxb	UTSW	17	34692333	nonsense	probably null
R1838:Tnxb	UTSW	17	34678910	missense	probably damaging	0.96
R1863:Tnxb	UTSW	17	34670874	missense	probably damaging	1.00
R1865:Tnxb	UTSW	17	34703457	nonsense	probably null
R1867:Tnxb	UTSW	17	34671847	missense	probably damaging	1.00
R1883:Tnxb	UTSW	17	34689565	missense	probably benign	0.01
R1884:Tnxb	UTSW	17	34689565	missense	probably benign	0.01
R1889:Tnxb	UTSW	17	34695825	missense	probably damaging	0.97
R1969:Tnxb	UTSW	17	34679081	missense	probably benign	0.20
R1989:Tnxb	UTSW	17	34683377	missense	probably benign	0.08
R1989:Tnxb	UTSW	17	34693885	missense	probably damaging	1.00
R1991:Tnxb	UTSW	17	34671904	missense	probably damaging	1.00
R1991:Tnxb	UTSW	17	34682251	missense	probably damaging	1.00
R1992:Tnxb	UTSW	17	34671904	missense	probably damaging	1.00
R2001:Tnxb	UTSW	17	34692579	missense	possibly damaging	0.82
R2018:Tnxb	UTSW	17	34671750	missense	probably benign	0.04
R2030:Tnxb	UTSW	17	34718469	missense	probably damaging	1.00
R2037:Tnxb	UTSW	17	34699205	missense	probably damaging	1.00
R2103:Tnxb	UTSW	17	34682251	missense	probably damaging	1.00
R2116:Tnxb	UTSW	17	34672227	missense	probably damaging	1.00
R2206:Tnxb	UTSW	17	34709417	missense	possibly damaging	0.86
R2207:Tnxb	UTSW	17	34709417	missense	possibly damaging	0.86
R2215:Tnxb	UTSW	17	34704140	missense	possibly damaging	0.93
R2413:Tnxb	UTSW	17	34718278	missense	probably damaging	0.99
R2680:Tnxb	UTSW	17	34703620	missense	possibly damaging	0.51
R2910:Tnxb	UTSW	17	34672450	missense	probably damaging	1.00
R2984:Tnxb	UTSW	17	34678662	nonsense	probably null
R3120:Tnxb	UTSW	17	34692355	missense	possibly damaging	0.86
R3429:Tnxb	UTSW	17	34672631	nonsense	probably null
R3429:Tnxb	UTSW	17	34703587	missense	probably damaging	0.98
R3552:Tnxb	UTSW	17	34718721	missense	probably damaging	1.00
R3698:Tnxb	UTSW	17	34690433	critical splice donor site	probably null
R3720:Tnxb	UTSW	17	34712964	missense	possibly damaging	0.95
R3841:Tnxb	UTSW	17	34698923	missense	possibly damaging	0.72
R3848:Tnxb	UTSW	17	34690395	missense	possibly damaging	0.82
R3886:Tnxb	UTSW	17	34718911	missense	probably damaging	1.00
R4074:Tnxb	UTSW	17	34671871	missense	probably benign	0.22
R4159:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4160:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4161:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4181:Tnxb	UTSW	17	34709454	missense	possibly damaging	0.93
R4210:Tnxb	UTSW	17	34710977	missense	possibly damaging	0.84
R4275:Tnxb	UTSW	17	34698231	missense	probably damaging	0.98
R4329:Tnxb	UTSW	17	34693864	missense	probably damaging	1.00
R4394:Tnxb	UTSW	17	34678662	nonsense	probably null
R4395:Tnxb	UTSW	17	34678662	nonsense	probably null
R4397:Tnxb	UTSW	17	34678662	nonsense	probably null
R4540:Tnxb	UTSW	17	34703335	missense	possibly damaging	0.86
R4673:Tnxb	UTSW	17	34672540	missense	probably damaging	0.99
R4719:Tnxb	UTSW	17	34689420	missense	probably damaging	1.00
R4725:Tnxb	UTSW	17	34699067	missense	probably damaging	0.99
R4753:Tnxb	UTSW	17	34695935	missense	possibly damaging	0.71
R4777:Tnxb	UTSW	17	34671943	missense	probably damaging	1.00
R4837:Tnxb	UTSW	17	34718007	missense	probably damaging	0.98
R4898:Tnxb	UTSW	17	34695592	missense	possibly damaging	0.95
R4938:Tnxb	UTSW	17	34713632	missense	probably damaging	1.00
R5044:Tnxb	UTSW	17	34717483	missense	probably damaging	1.00
R5100:Tnxb	UTSW	17	34710928	missense	probably damaging	0.99
R5223:Tnxb	UTSW	17	34704078	missense	possibly damaging	0.51
R5269:Tnxb	UTSW	17	34703608	missense	possibly damaging	0.95
R5333:Tnxb	UTSW	17	34690231	missense	probably damaging	1.00
R5454:Tnxb	UTSW	17	34709625	missense	possibly damaging	0.71
R5470:Tnxb	UTSW	17	34716973	missense	probably null	1.00
R5475:Tnxb	UTSW	17	34689593	missense	probably damaging	1.00
R5574:Tnxb	UTSW	17	34711024	missense	probably benign
R5596:Tnxb	UTSW	17	34688804	missense	probably damaging	1.00
R5599:Tnxb	UTSW	17	34690202	missense	probably damaging	1.00
R5599:Tnxb	UTSW	17	34690205	missense	probably benign	0.22
R5615:Tnxb	UTSW	17	34683418	missense	probably damaging	1.00
R5620:Tnxb	UTSW	17	34717530	nonsense	probably null
R5625:Tnxb	UTSW	17	34685211	missense	probably benign	0.30
R5734:Tnxb	UTSW	17	34698910	missense	possibly damaging	0.53
R5896:Tnxb	UTSW	17	34672152	missense	probably damaging	1.00
R5961:Tnxb	UTSW	17	34718635	missense	probably damaging	1.00
R5974:Tnxb	UTSW	17	34685707	missense	probably damaging	1.00
R6091:Tnxb	UTSW	17	34710364	missense	probably damaging	0.98
R6134:Tnxb	UTSW	17	34672012	missense	probably damaging	0.96
R6325:Tnxb	UTSW	17	34692424	missense	probably damaging	1.00
R6358:Tnxb	UTSW	17	34678994	missense	probably damaging	0.98
R6362:Tnxb	UTSW	17	34694388	missense	probably damaging	1.00
R6432:Tnxb	UTSW	17	34717917	missense	probably damaging	1.00
R6461:Tnxb	UTSW	17	34671898	missense	probably damaging	1.00
R6467:Tnxb	UTSW	17	34693924	missense	probably damaging	1.00
R6476:Tnxb	UTSW	17	34690192	missense	probably damaging	0.98
R6477:Tnxb	UTSW	17	34719539	missense	probably damaging	1.00
R6631:Tnxb	UTSW	17	34718248	missense	probably damaging	1.00
R6774:Tnxb	UTSW	17	34709632	nonsense	probably null
R6787:Tnxb	UTSW	17	34710736	missense	probably benign	0.02
R6805:Tnxb	UTSW	17	34698153	missense	possibly damaging	0.93
R6860:Tnxb	UTSW	17	34713157	missense	probably damaging	0.99
R6883:Tnxb	UTSW	17	34718519	missense	probably damaging	1.00
R7049:Tnxb	UTSW	17	34717268	critical splice donor site	probably null
R7107:Tnxb	UTSW	17	34671340	missense	unknown
R7172:Tnxb	UTSW	17	34696020	missense	probably damaging	1.00
R7206:Tnxb	UTSW	17	34704101	missense	possibly damaging	0.71
R7219:Tnxb	UTSW	17	34679065	missense	probably benign	0.08
R7237:Tnxb	UTSW	17	34682196	missense	possibly damaging	0.82
R7257:Tnxb	UTSW	17	34716501	missense	probably benign	0.44
R7269:Tnxb	UTSW	17	34695454	missense	probably damaging	1.00
R7302:Tnxb	UTSW	17	34678901	missense	probably benign	0.41
R7372:Tnxb	UTSW	17	34717254	missense	possibly damaging	0.72
R7384:Tnxb	UTSW	17	34718518	missense	probably damaging	1.00
R7447:Tnxb	UTSW	17	34718470	missense	probably damaging	1.00
R7449:Tnxb	UTSW	17	34703361	missense	possibly damaging	0.93
R7480:Tnxb	UTSW	17	34715773	missense	probably damaging	0.96
R7506:Tnxb	UTSW	17	34715691	missense	possibly damaging	0.89
R7586:Tnxb	UTSW	17	34716408	missense	probably damaging	0.98
R7688:Tnxb	UTSW	17	34671906	missense	probably benign	0.23
R7690:Tnxb	UTSW	17	34689520	missense	probably benign	0.03
R7690:Tnxb	UTSW	17	34689527	missense	probably damaging	1.00
R7732:Tnxb	UTSW	17	34694280	missense	probably damaging	1.00
R7735:Tnxb	UTSW	17	34671424	missense	unknown
R7760:Tnxb	UTSW	17	34712937	missense	probably damaging	0.96
R7874:Tnxb	UTSW	17	34711443	missense	probably damaging	1.00
R7909:Tnxb	UTSW	17	34692454	missense	probably benign	0.02
R7922:Tnxb	UTSW	17	34714603	missense	probably damaging	1.00
R7931:Tnxb	UTSW	17	34688698	missense	probably damaging	1.00
R7949:Tnxb	UTSW	17	34717129	missense	probably damaging	1.00
R7953:Tnxb	UTSW	17	34709535	missense	possibly damaging	0.86
R7953:Tnxb	UTSW	17	34710103	missense	probably benign	0.03
R7977:Tnxb	UTSW	17	34710220	missense	possibly damaging	0.92
R7985:Tnxb	UTSW	17	34717010	critical splice donor site	probably null
R7987:Tnxb	UTSW	17	34710220	missense	possibly damaging	0.92
R8040:Tnxb	UTSW	17	34716558	missense	probably damaging	1.00
R8053:Tnxb	UTSW	17	34704179	missense	probably damaging	0.98
R8074:Tnxb	UTSW	17	34703981	missense	probably benign	0.32
R8089:Tnxb	UTSW	17	34672789	missense	unknown
R8169:Tnxb	UTSW	17	34699207	missense	possibly damaging	0.96
R8348:Tnxb	UTSW	17	34710128	missense	possibly damaging	0.92
R8352:Tnxb	UTSW	17	34689407	missense	probably damaging	1.00
R8362:Tnxb	UTSW	17	34712972	missense	probably damaging	0.99
R8452:Tnxb	UTSW	17	34689407	missense	probably damaging	1.00
R8527:Tnxb	UTSW	17	34688660	missense	probably damaging	1.00
R8754:Tnxb	UTSW	17	34715908	missense	probably damaging	1.00
R8813:Tnxb	UTSW	17	34719162	missense	probably damaging	1.00
R8936:Tnxb	UTSW	17	34685672	missense	probably damaging	1.00
R8986:Tnxb	UTSW	17	34678672	missense	possibly damaging	0.66
R9001:Tnxb	UTSW	17	34703436	missense	probably benign	0.32
R9215:Tnxb	UTSW	17	34672590	missense	unknown
R9226:Tnxb	UTSW	17	34685792	missense	probably damaging	1.00
R9276:Tnxb	UTSW	17	34710160	missense	possibly damaging	0.60
R9279:Tnxb	UTSW	17	34679114	missense	possibly damaging	0.46
R9363:Tnxb	UTSW	17	34698320	missense	possibly damaging	0.93
R9367:Tnxb	UTSW	17	34713019	missense	probably damaging	1.00
R9494:Tnxb	UTSW	17	34685822	missense	probably damaging	1.00
R9606:Tnxb	UTSW	17	34695604	missense	possibly damaging	0.82
R9650:Tnxb	UTSW	17	34711655	missense	probably damaging	0.99
R9677:Tnxb	UTSW	17	34698904	missense	possibly damaging	0.93
R9690:Tnxb	UTSW	17	34717197	missense	probably damaging	1.00
R9761:Tnxb	UTSW	17	34685013	missense	probably benign	0.32
X0004:Tnxb	UTSW	17	34703415	missense	possibly damaging	0.71
X0010:Tnxb	UTSW	17	34671934	missense	probably damaging	1.00
X0019:Tnxb	UTSW	17	34694189	missense	possibly damaging	0.51
X0063:Tnxb	UTSW	17	34703508	missense	probably damaging	0.98
X0064:Tnxb	UTSW	17	34694032	missense	probably damaging	1.00
Z1177:Tnxb	UTSW	17	34671766	missense	unknown
Z1177:Tnxb	UTSW	17	34683331	missense	probably damaging	1.00
Z1177:Tnxb	UTSW	17	34718726	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCATTCCACGCGGCTTGATTTG -3'
(R):5'- ACCTCCATCAGTCTCCATGTCACAG -3'

Sequencing Primer
(F):5'- CGGCTTGATTTGGAGGTGC -3'
(R):5'- CTCACGGTTGCCATTGAGG -3'

Posted On

2013-06-11