Incidental Mutation 'R0499:Ankmy1'
ID 46983
Institutional Source Beutler Lab
Gene Symbol Ankmy1
Ensembl Gene ENSMUSG00000034212
Gene Name ankyrin repeat and MYND domain containing 1
Synonyms 4930483I10Rik
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R0499 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 92859803-92902906 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 92886226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 410 (D410E)
Ref Sequence ENSEMBL: ENSMUSP00000108622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112998] [ENSMUST00000160548]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112998
AA Change: D410E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108622
Gene: ENSMUSG00000034212
AA Change: D410E

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 940 980 1.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160548
AA Change: D410E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123787
Gene: ENSMUSG00000034212
AA Change: D410E

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 941 981 2.3e-8 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Ankmy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ankmy1 APN 1 92886266 missense probably damaging 1.00
IGL01061:Ankmy1 APN 1 92870974 splice site probably benign
IGL01960:Ankmy1 APN 1 92871663 splice site probably benign
IGL01984:Ankmy1 APN 1 92883765 missense probably damaging 0.99
IGL02193:Ankmy1 APN 1 92881045 missense probably benign 0.03
IGL02536:Ankmy1 APN 1 92886188 missense probably damaging 1.00
IGL02644:Ankmy1 APN 1 92885054 missense probably benign 0.18
IGL02650:Ankmy1 APN 1 92881023 missense probably damaging 1.00
IGL02660:Ankmy1 APN 1 92896094 missense probably damaging 1.00
IGL02808:Ankmy1 APN 1 92886666 missense probably damaging 1.00
bali UTSW 1 92871722 missense probably damaging 1.00
timor UTSW 1 92886281 missense probably benign 0.02
PIT4687001:Ankmy1 UTSW 1 92885081 missense probably benign 0.00
R0313:Ankmy1 UTSW 1 92886221 missense probably damaging 1.00
R0373:Ankmy1 UTSW 1 92896190 missense probably damaging 0.99
R0383:Ankmy1 UTSW 1 92885053 missense probably benign 0.00
R0562:Ankmy1 UTSW 1 92899691 splice site probably benign
R0607:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R0739:Ankmy1 UTSW 1 92888648 missense probably damaging 1.00
R0962:Ankmy1 UTSW 1 92899568 nonsense probably null
R1192:Ankmy1 UTSW 1 92883894 missense probably damaging 0.99
R1491:Ankmy1 UTSW 1 92886809 missense probably benign 0.02
R1568:Ankmy1 UTSW 1 92881116 missense probably damaging 1.00
R1585:Ankmy1 UTSW 1 92899651 missense probably benign 0.00
R1590:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R1664:Ankmy1 UTSW 1 92885191 missense probably benign 0.00
R1714:Ankmy1 UTSW 1 92885194 nonsense probably null
R1818:Ankmy1 UTSW 1 92886831 missense probably benign 0.43
R2014:Ankmy1 UTSW 1 92885141 missense probably benign 0.00
R2043:Ankmy1 UTSW 1 92876527 unclassified probably benign
R2056:Ankmy1 UTSW 1 92881831 missense possibly damaging 0.61
R2427:Ankmy1 UTSW 1 92870807 critical splice donor site probably null
R3806:Ankmy1 UTSW 1 92883758 missense possibly damaging 0.92
R3883:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R3884:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R4118:Ankmy1 UTSW 1 92888696 missense possibly damaging 0.60
R4132:Ankmy1 UTSW 1 92885100 missense probably benign
R4441:Ankmy1 UTSW 1 92888661 missense possibly damaging 0.92
R4543:Ankmy1 UTSW 1 92884850 missense probably damaging 1.00
R4602:Ankmy1 UTSW 1 92888650 missense probably benign 0.38
R4779:Ankmy1 UTSW 1 92886723 missense probably benign 0.23
R5200:Ankmy1 UTSW 1 92870292 missense probably benign 0.00
R5381:Ankmy1 UTSW 1 92876562 missense probably benign
R5425:Ankmy1 UTSW 1 92870957 nonsense probably null
R5474:Ankmy1 UTSW 1 92885204 missense possibly damaging 0.59
R5534:Ankmy1 UTSW 1 92886720 missense probably damaging 1.00
R5607:Ankmy1 UTSW 1 92877018 missense probably damaging 1.00
R6112:Ankmy1 UTSW 1 92870962 missense probably damaging 1.00
R6117:Ankmy1 UTSW 1 92861274 unclassified probably benign
R6376:Ankmy1 UTSW 1 92888465 missense possibly damaging 0.60
R6712:Ankmy1 UTSW 1 92870922 missense probably damaging 1.00
R6915:Ankmy1 UTSW 1 92888451 missense probably null 1.00
R7201:Ankmy1 UTSW 1 92886824 missense possibly damaging 0.95
R7432:Ankmy1 UTSW 1 92896079 missense probably benign
R7485:Ankmy1 UTSW 1 92876657 missense probably damaging 0.99
R7795:Ankmy1 UTSW 1 92883848 missense probably benign
R7851:Ankmy1 UTSW 1 92871722 missense probably damaging 1.00
R8018:Ankmy1 UTSW 1 92886281 missense probably benign 0.02
R8024:Ankmy1 UTSW 1 92884994 missense probably benign
R8276:Ankmy1 UTSW 1 92886809 missense probably benign 0.02
R8350:Ankmy1 UTSW 1 92876631 missense possibly damaging 0.87
R8373:Ankmy1 UTSW 1 92896094 missense probably damaging 0.98
R8683:Ankmy1 UTSW 1 92885250 missense possibly damaging 0.96
Z1176:Ankmy1 UTSW 1 92878437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGAGAAGCCCCTGTCCTGAAG -3'
(R):5'- CTGCTCATTGCAGCCTTGATGC -3'

Sequencing Primer
(F):5'- ccctgtcctgaagacctcc -3'
(R):5'- TGAGGGCTATCTCCTGTGTT -3'
Posted On 2013-06-12