Incidental Mutation 'R0499:Pdcd10'
ID 46994
Institutional Source Beutler Lab
Gene Symbol Pdcd10
Ensembl Gene ENSMUSG00000027835
Gene Name programmed cell death 10
Synonyms Tfa15, TF-1 cell apoptosis related protein-15, 2410003B13Rik, CCM3
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0499 (G1)
Quality Score 199
Status Validated
Chromosome 3
Chromosomal Location 75516490-75556856 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75527651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 111 (K111R)
Ref Sequence ENSEMBL: ENSMUSP00000125752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029424] [ENSMUST00000161137] [ENSMUST00000162138]
AlphaFold Q8VE70
Predicted Effect probably damaging
Transcript: ENSMUST00000029424
AA Change: K48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029424
Gene: ENSMUSG00000027835
AA Change: K48R

DomainStartEndE-ValueType
Pfam:DUF1241 1 99 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161137
AA Change: K111R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125752
Gene: ENSMUSG00000027835
AA Change: K111R

DomainStartEndE-ValueType
Pfam:DUF1241 14 161 1.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162138
SMART Domains Protein: ENSMUSP00000124421
Gene: ENSMUSG00000027835

DomainStartEndE-ValueType
Pfam:DUF1241 10 66 5.4e-21 PFAM
Meta Mutation Damage Score 0.4796 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved protein associated with cell apoptosis. The protein interacts with the serine/threonine protein kinase MST4 to modulate the extracellular signal-regulated kinase (ERK) pathway. It also interacts with and is phosphoryated by serine/threonine kinase 25, and is thought to function in a signaling pathway essential for vascular developent. Mutations in this gene are one cause of cerebral cavernous malformations, which are vascular malformations that cause seizures and cerebral hemorrhages. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal due to impaired hematopoeisis, vasculogenesis, and abnormal heart morphology. Conditional knockout in myeloids increases degranulation of, and exocytosis by, neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Pdcd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Pdcd10 APN 3 75541233 missense probably damaging 0.98
IGL01545:Pdcd10 APN 3 75541168 missense possibly damaging 0.57
IGL02179:Pdcd10 APN 3 75527615 missense probably damaging 1.00
IGL02675:Pdcd10 APN 3 75527594 missense probably damaging 1.00
R0299:Pdcd10 UTSW 3 75527651 missense probably damaging 1.00
R1674:Pdcd10 UTSW 3 75541179 missense probably damaging 0.99
R4197:Pdcd10 UTSW 3 75517592 missense possibly damaging 0.77
R4615:Pdcd10 UTSW 3 75521091 missense probably damaging 1.00
R4908:Pdcd10 UTSW 3 75541246 missense probably damaging 0.98
R5469:Pdcd10 UTSW 3 75521057 nonsense probably null
R6628:Pdcd10 UTSW 3 75521071 missense probably damaging 1.00
R9358:Pdcd10 UTSW 3 75541226 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTTTAGTCCACTACGTCATTGGTGC -3'
(R):5'- ACTGGACCAAGTTGAACTTCGTTTCTC -3'

Sequencing Primer
(F):5'- CTCTGAGGCCATTATATTCAAAGTCC -3'
(R):5'- AAGTTGAACTTCGTTTCTCTTTTTG -3'
Posted On 2013-06-12