Incidental Mutation 'R0499:Pde5a'
ID 46997
Institutional Source Beutler Lab
Gene Symbol Pde5a
Ensembl Gene ENSMUSG00000053965
Gene Name phosphodiesterase 5A, cGMP-specific
Synonyms PDE5A1, Pde5
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock # R0499 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 122728947-122859374 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122748458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 199 (N199S)
Ref Sequence ENSEMBL: ENSMUSP00000143042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066728] [ENSMUST00000200389]
AlphaFold Q8CG03
Predicted Effect probably damaging
Transcript: ENSMUST00000066728
AA Change: N231S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069011
Gene: ENSMUSG00000053965
AA Change: N231S

DomainStartEndE-ValueType
Blast:GAF 64 152 4e-42 BLAST
GAF 154 314 2.23e-31 SMART
GAF 336 503 9.8e-28 SMART
HDc 600 768 8.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198314
Predicted Effect probably damaging
Transcript: ENSMUST00000200389
AA Change: N199S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143042
Gene: ENSMUSG00000053965
AA Change: N199S

DomainStartEndE-ValueType
Blast:GAF 32 120 3e-42 BLAST
GAF 122 282 1.1e-33 SMART
GAF 304 471 4.7e-30 SMART
HDc 568 736 4.4e-11 SMART
Meta Mutation Damage Score 0.4876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. Alternative splicing of this gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Pde5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pde5a APN 3 122794357 missense probably damaging 1.00
IGL00945:Pde5a APN 3 122835642 critical splice donor site probably null
IGL01395:Pde5a APN 3 122817955 missense probably benign 0.40
IGL01872:Pde5a APN 3 122794369 critical splice donor site probably null
IGL01947:Pde5a APN 3 122835610 missense probably damaging 1.00
IGL02033:Pde5a APN 3 122803061 missense possibly damaging 0.51
IGL02209:Pde5a APN 3 122825015 splice site probably benign
IGL02220:Pde5a APN 3 122748382 missense probably benign 0.05
IGL02301:Pde5a APN 3 122760885 missense probably damaging 1.00
IGL02748:Pde5a APN 3 122760892 missense probably damaging 0.99
R0009:Pde5a UTSW 3 122824902 splice site probably benign
R0031:Pde5a UTSW 3 122803055 missense probably benign 0.00
R0119:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0390:Pde5a UTSW 3 122835583 missense probably damaging 1.00
R0481:Pde5a UTSW 3 122818077 splice site probably benign
R0657:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0845:Pde5a UTSW 3 122729331 missense probably benign 0.28
R0908:Pde5a UTSW 3 122779001 missense probably benign 0.01
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1553:Pde5a UTSW 3 122778936 missense probably benign 0.14
R1728:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R1744:Pde5a UTSW 3 122747897 missense probably damaging 0.97
R1774:Pde5a UTSW 3 122729364 missense probably benign 0.01
R1784:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R2437:Pde5a UTSW 3 122843053 missense probably damaging 1.00
R2844:Pde5a UTSW 3 122851708 missense probably damaging 1.00
R2897:Pde5a UTSW 3 122779002 missense probably benign 0.03
R2936:Pde5a UTSW 3 122794319 missense probably damaging 0.97
R3160:Pde5a UTSW 3 122781628 nonsense probably null
R3162:Pde5a UTSW 3 122781628 nonsense probably null
R3704:Pde5a UTSW 3 122779019 missense probably benign 0.00
R3847:Pde5a UTSW 3 122803160 missense probably damaging 0.98
R3932:Pde5a UTSW 3 122760896 missense probably damaging 0.98
R4387:Pde5a UTSW 3 122729352 missense probably benign 0.00
R4613:Pde5a UTSW 3 122823093 missense probably damaging 1.00
R4676:Pde5a UTSW 3 122747893 missense possibly damaging 0.67
R5034:Pde5a UTSW 3 122852586 missense probably damaging 1.00
R5034:Pde5a UTSW 3 122852587 missense probably damaging 1.00
R5358:Pde5a UTSW 3 122748176 missense probably damaging 1.00
R5394:Pde5a UTSW 3 122818009 missense probably damaging 1.00
R5502:Pde5a UTSW 3 122803032 missense probably damaging 1.00
R5821:Pde5a UTSW 3 122817955 missense probably benign 0.40
R5932:Pde5a UTSW 3 122841044 missense probably benign 0.01
R6063:Pde5a UTSW 3 122824925 missense probably benign 0.23
R6190:Pde5a UTSW 3 122729307 missense probably benign 0.28
R6815:Pde5a UTSW 3 122824924 missense probably benign 0.01
R6940:Pde5a UTSW 3 122779032 missense possibly damaging 0.53
R7274:Pde5a UTSW 3 122855246 nonsense probably null
R7337:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R7384:Pde5a UTSW 3 122825000 missense probably damaging 1.00
R7480:Pde5a UTSW 3 122803148 missense possibly damaging 0.50
R7508:Pde5a UTSW 3 122818030 missense probably damaging 1.00
R7522:Pde5a UTSW 3 122840999 nonsense probably null
R7623:Pde5a UTSW 3 122774601 missense probably benign
R8153:Pde5a UTSW 3 122852576 missense probably benign 0.30
R8153:Pde5a UTSW 3 122852578 missense probably damaging 1.00
R8351:Pde5a UTSW 3 122748479 critical splice donor site probably null
R8927:Pde5a UTSW 3 122839600 missense probably damaging 1.00
R8928:Pde5a UTSW 3 122839600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACAGTGAGCTTTCTCTCTGAC -3'
(R):5'- AGCAGTGCTCCTATCCTAGACTCTTTG -3'

Sequencing Primer
(F):5'- CCCCCCAAGATTTGATAGTGATG -3'
(R):5'- agattcaatccaagactttgcac -3'
Posted On 2013-06-12