Mutagenetix > Incidental Mutations

Incidental Mutation 'R0499:Ints8'

46998

Institutional Source

Beutler Lab

Gene Symbol

Ints8

Ensembl Gene

ENSMUSG00000040738

Gene Name

integrator complex subunit 8

Synonyms

2810013E07Rik, D130008D20Rik

MMRRC Submission

038695-MU

Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R0499 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

11199158-11254258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 11246097 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 190 (V190L)

Ref Sequence

ENSEMBL: ENSMUSP00000103955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]

Predicted Effect

probably benign
Transcript: ENSMUST00000044616
AA Change: V190L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: V190L

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108318
AA Change: V190L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: V190L

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC
SCOP:d1a17__	826	961	9e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108319
AA Change: V190L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: V190L

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Meta Mutation Damage Score

0.1008

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	C	3: 36,085,415	V388A	probably damaging	Het
Acpp	T	C	9: 104,320,002	E146G	probably damaging	Het
Adap2	A	T	11: 80,176,079	R276S	probably damaging	Het
Agbl3	A	T	6: 34,839,335	M727L	probably benign	Het
Ahnak	T	A	19: 9,000,264		probably benign	Het
Ankmy1	G	T	1: 92,886,226	D410E	probably damaging	Het
Ankra2	T	C	13: 98,266,454	S70P	probably damaging	Het
Aox4	T	C	1: 58,263,397		probably null	Het
Arl13b	G	A	16: 62,801,733	T399I	probably benign	Het
Atad2	A	T	15: 58,103,240	D652E	possibly damaging	Het
Atad2	T	G	15: 58,120,949	M328L	probably benign	Het
BC052040	C	T	2: 115,642,691	R101W	probably damaging	Het
Ccnb1	T	C	13: 100,780,134		probably null	Het
Ccr2	G	C	9: 124,105,939	K85N	possibly damaging	Het
Ccr2	A	T	9: 124,106,126	T148S	possibly damaging	Het
Cdc20b	T	C	13: 113,055,950	V59A	probably benign	Het
Cdkl3	T	C	11: 52,032,416	S507P	possibly damaging	Het
Celf6	C	A	9: 59,602,878	T86K	probably benign	Het
Ces1g	A	G	8: 93,333,689	F101L	probably benign	Het
Cntnap3	C	T	13: 64,858,678	D107N	probably benign	Het
Col15a1	A	T	4: 47,262,950	D534V	probably damaging	Het
Col27a1	A	G	4: 63,300,741		probably benign	Het
Csmd3	T	C	15: 47,847,131	T1687A	probably benign	Het
Cstf3	A	G	2: 104,649,605	I272M	possibly damaging	Het
Cyp2d40	T	C	15: 82,761,217	T150A	probably benign	Het
Dnah8	T	A	17: 30,715,509	F1489L	possibly damaging	Het
Dopey2	A	T	16: 93,770,437	T1251S	probably benign	Het
Dtx2	G	A	5: 136,029,103	G421R	probably damaging	Het
Dusp27	C	A	1: 166,099,101	V981L	probably benign	Het
Epb41l3	T	A	17: 69,247,659	D251E	probably benign	Het
Erg	A	C	16: 95,360,983	Y305*	probably null	Het
Exosc4	G	A	15: 76,329,566	A197T	probably benign	Het
Fam227b	T	A	2: 126,100,909	I323L	probably benign	Het
Far1	G	T	7: 113,554,296		probably benign	Het
Fmod	A	G	1: 134,041,196	I325V	possibly damaging	Het
Fshr	C	G	17: 89,009,285	S169T	probably benign	Het
Gm17359	T	A	3: 79,405,786	W56R	probably damaging	Het
Gm17660	C	A	5: 104,074,881	G24*	probably null	Het
Gm4076	G	T	13: 85,127,226		noncoding transcript	Het
Gm5134	A	T	10: 75,992,525	Y313F	probably benign	Het
H2-Q6	T	A	17: 35,425,203	F54I	probably damaging	Het
Hcrtr2	C	A	9: 76,254,672	L145F	probably damaging	Het
Hepacam2	A	G	6: 3,476,121	L268P	probably damaging	Het
Herc2	C	A	7: 56,184,369	C3107*	probably null	Het
Herc4	T	C	10: 63,264,032	V78A	probably damaging	Het
Hyal5	T	C	6: 24,877,921	W339R	probably damaging	Het
Igfbp6	T	A	15: 102,147,984		probably null	Het
Il18rap	A	T	1: 40,525,058	H112L	probably benign	Het
Il1r2	T	A	1: 40,123,149	Y317*	probably null	Het
Ipo11	T	C	13: 106,925,087	T22A	probably benign	Het
Itgb4	C	A	11: 115,979,695	R117S	probably benign	Het
Lcorl	C	G	5: 45,734,369	G214A	probably benign	Het
Lgals3bp	T	A	11: 118,398,193		probably null	Het
Lyst	T	A	13: 13,616,713	L54I	probably damaging	Het
Mcm9	T	C	10: 53,538,154	T1015A	probably benign	Het
Mef2d	T	A	3: 88,156,518	I84N	probably damaging	Het
Mmrn2	A	G	14: 34,397,956	N261S	probably damaging	Het
Mpdz	T	C	4: 81,292,531	T1693A	probably benign	Het
Mss51	T	A	14: 20,484,688	Q338L	possibly damaging	Het
Mstn	T	A	1: 53,063,984	Y160N	probably damaging	Het
Muc6	T	C	7: 141,640,468	T1431A	probably benign	Het
Nek9	A	T	12: 85,301,883	M959K	probably benign	Het
Odf3l2	T	C	10: 79,640,265	D155G	probably damaging	Het
Olfr1311	A	T	2: 112,021,432	C141S	probably damaging	Het
Olfr319	G	A	11: 58,702,243	V181I	probably benign	Het
Olfr911-ps1	A	T	9: 38,524,505	M258L	probably benign	Het
Otog	G	T	7: 46,273,832	G1044W	probably damaging	Het
Pcdh9	G	A	14: 93,886,235	T833M	probably damaging	Het
Pdcd10	T	C	3: 75,527,651	K111R	probably damaging	Het
Pde5a	A	G	3: 122,748,458	N199S	probably damaging	Het
Plekhg1	T	C	10: 3,937,971	V355A	probably damaging	Het
Podn	G	T	4: 108,021,594	L359I	probably damaging	Het
Psd	T	C	19: 46,322,161	E483G	probably damaging	Het
Ptch2	T	A	4: 117,111,143	L905*	probably null	Het
Rxfp2	T	A	5: 150,066,415	N420K	probably damaging	Het
Sde2	T	A	1: 180,862,427	D237E	probably benign	Het
Serpina1d	A	T	12: 103,765,757	L281Q	probably damaging	Het
Serpina9	T	C	12: 104,001,470	N222S	probably benign	Het
Sh3bgrl2	A	G	9: 83,577,559	K57E	probably damaging	Het
Shc3	C	T	13: 51,480,228		probably benign	Het
Sik3	T	C	9: 46,208,740	M659T	possibly damaging	Het
Slc23a2	A	G	2: 132,072,017	L280P	probably damaging	Het
Smchd1	G	T	17: 71,387,088	Q1221K	probably benign	Het
Spocd1	A	G	4: 129,955,470	N694S	possibly damaging	Het
Tecta	T	C	9: 42,352,063	D1409G	probably damaging	Het
Tmem131	A	T	1: 36,841,673	V172D	probably damaging	Het
Trpm3	T	C	19: 22,986,873	M1244T	possibly damaging	Het
Ugcg	G	C	4: 59,217,036	V187L	possibly damaging	Het
Usp17le	T	C	7: 104,768,501	N478S	probably benign	Het
Usp36	A	G	11: 118,273,571	V205A	probably damaging	Het
Vmn1r25	T	A	6: 57,978,509	Q265L	probably damaging	Het
Vwf	A	T	6: 125,638,114	H1176L	probably benign	Het
Zfyve28	C	T	5: 34,232,206	D217N	possibly damaging	Het
Zranb3	A	C	1: 127,955,080		probably null	Het

Other mutations in Ints8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01390:Ints8	APN	4	11218679	splice site	probably benign
IGL01925:Ints8	APN	4	11235617	splice site	probably benign
IGL02195:Ints8	APN	4	11221222	missense	probably damaging	1.00
IGL02215:Ints8	APN	4	11209244	missense	probably damaging	1.00
IGL02429:Ints8	APN	4	11231720	missense	probably damaging	1.00
IGL02484:Ints8	APN	4	11208834	nonsense	probably null
IGL02558:Ints8	APN	4	11218771	missense	probably damaging	1.00
IGL02725:Ints8	APN	4	11239406	missense	probably benign	0.01
IGL02742:Ints8	APN	4	11241627	missense	possibly damaging	0.75
IGL02831:Ints8	APN	4	11245896	missense	possibly damaging	0.51
IGL03140:Ints8	APN	4	11235565	missense	probably damaging	1.00
IGL03171:Ints8	APN	4	11231702	missense	probably benign	0.01
IGL03335:Ints8	APN	4	11216460	missense	probably damaging	1.00
G1Funyon:Ints8	UTSW	4	11246120	missense	probably damaging	1.00
P0026:Ints8	UTSW	4	11225788	nonsense	probably null
R0054:Ints8	UTSW	4	11204595	utr 3 prime	probably benign
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0184:Ints8	UTSW	4	11218637	missense	probably benign	0.03
R0299:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R0540:Ints8	UTSW	4	11252926	missense	possibly damaging	0.94
R0657:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R1232:Ints8	UTSW	4	11234587	missense	possibly damaging	0.81
R1296:Ints8	UTSW	4	11221204	missense	possibly damaging	0.95
R1390:Ints8	UTSW	4	11239461	missense	probably benign	0.22
R1503:Ints8	UTSW	4	11245842	missense	probably damaging	0.97
R1587:Ints8	UTSW	4	11245722	critical splice donor site	probably null
R1701:Ints8	UTSW	4	11231656	missense	probably damaging	1.00
R1721:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1757:Ints8	UTSW	4	11254109	start codon destroyed	probably null	0.99
R1777:Ints8	UTSW	4	11225600	critical splice donor site	probably null
R1867:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1868:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1952:Ints8	UTSW	4	11221150	missense	probably benign	0.21
R2084:Ints8	UTSW	4	11230377	missense	probably benign	0.31
R2108:Ints8	UTSW	4	11235552	missense	probably damaging	0.99
R2202:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2203:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2205:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2439:Ints8	UTSW	4	11225725	missense	probably benign	0.29
R2504:Ints8	UTSW	4	11241642	missense	probably benign	0.03
R3824:Ints8	UTSW	4	11225621	nonsense	probably null
R4664:Ints8	UTSW	4	11227152	missense	probably benign	0.04
R4703:Ints8	UTSW	4	11223785	missense	possibly damaging	0.92
R4895:Ints8	UTSW	4	11230367	nonsense	probably null
R5206:Ints8	UTSW	4	11216477	missense	possibly damaging	0.65
R5262:Ints8	UTSW	4	11211916	missense	probably damaging	1.00
R5505:Ints8	UTSW	4	11221143	missense	probably benign	0.18
R5513:Ints8	UTSW	4	11248303	missense	possibly damaging	0.79
R5750:Ints8	UTSW	4	11241654	missense	possibly damaging	0.81
R5892:Ints8	UTSW	4	11223813	missense	probably damaging	1.00
R6007:Ints8	UTSW	4	11208845	missense	possibly damaging	0.70
R6229:Ints8	UTSW	4	11252891	missense	probably damaging	1.00
R6466:Ints8	UTSW	4	11252878	missense	probably damaging	0.99
R6709:Ints8	UTSW	4	11221117	missense	possibly damaging	0.65
R6986:Ints8	UTSW	4	11204474	missense	probably damaging	1.00
R6998:Ints8	UTSW	4	11204537	missense	possibly damaging	0.80
R7074:Ints8	UTSW	4	11204574	missense	possibly damaging	0.82
R7221:Ints8	UTSW	4	11225613	missense	probably benign	0.01
R7772:Ints8	UTSW	4	11227190	missense	probably damaging	0.97
R7872:Ints8	UTSW	4	11254062	missense	probably benign	0.00
R7953:Ints8	UTSW	4	11227128	missense	probably benign
R8184:Ints8	UTSW	4	11204534	missense	probably damaging	1.00
R8301:Ints8	UTSW	4	11246120	missense	probably damaging	1.00
R8708:Ints8	UTSW	4	11208824	critical splice donor site	probably null
R8868:Ints8	UTSW	4	11230488	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGCTGCTTCCAGGACCAAAATAC -3'
(R):5'- ACCTTGATTGTTCCTGAAGCTCCAC -3'

Sequencing Primer
(F):5'- ACAATCAGCAGCTTGTTCTTTTAGC -3'
(R):5'- AGCACTTGAGAAGGCCCTG -3'

Posted On

2013-06-12