Mutagenetix > Incidental Mutations

Incidental Mutation 'R0499:Ugcg'

47000

Institutional Source

Beutler Lab

Gene Symbol

Ugcg

Ensembl Gene

ENSMUSG00000028381

Gene Name

UDP-glucose ceramide glucosyltransferase

Synonyms

Epcs21, Ugcgl, GlcT-1

MMRRC Submission

038695-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0499 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59189257-59222833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 59217036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 187 (V187L)

Ref Sequence

ENSEMBL: ENSMUSP00000030074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030074]

AlphaFold

O88693

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030074
AA Change: V187L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: V187L

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	51	278	1.3e-26	PFAM
Pfam:Glyco_transf_21	106	278	8.4e-61	PFAM
Pfam:Glyco_trans_2_3	139	368	9.6e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155153

Meta Mutation Damage Score

0.1422

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	C	3: 36,085,415	V388A	probably damaging	Het
Acpp	T	C	9: 104,320,002	E146G	probably damaging	Het
Adap2	A	T	11: 80,176,079	R276S	probably damaging	Het
Agbl3	A	T	6: 34,839,335	M727L	probably benign	Het
Ahnak	T	A	19: 9,000,264		probably benign	Het
Ankmy1	G	T	1: 92,886,226	D410E	probably damaging	Het
Ankra2	T	C	13: 98,266,454	S70P	probably damaging	Het
Aox4	T	C	1: 58,263,397		probably null	Het
Arl13b	G	A	16: 62,801,733	T399I	probably benign	Het
Atad2	A	T	15: 58,103,240	D652E	possibly damaging	Het
Atad2	T	G	15: 58,120,949	M328L	probably benign	Het
BC052040	C	T	2: 115,642,691	R101W	probably damaging	Het
Ccnb1	T	C	13: 100,780,134		probably null	Het
Ccr2	G	C	9: 124,105,939	K85N	possibly damaging	Het
Ccr2	A	T	9: 124,106,126	T148S	possibly damaging	Het
Cdc20b	T	C	13: 113,055,950	V59A	probably benign	Het
Cdkl3	T	C	11: 52,032,416	S507P	possibly damaging	Het
Celf6	C	A	9: 59,602,878	T86K	probably benign	Het
Ces1g	A	G	8: 93,333,689	F101L	probably benign	Het
Cntnap3	C	T	13: 64,858,678	D107N	probably benign	Het
Col15a1	A	T	4: 47,262,950	D534V	probably damaging	Het
Col27a1	A	G	4: 63,300,741		probably benign	Het
Csmd3	T	C	15: 47,847,131	T1687A	probably benign	Het
Cstf3	A	G	2: 104,649,605	I272M	possibly damaging	Het
Cyp2d40	T	C	15: 82,761,217	T150A	probably benign	Het
Dnah8	T	A	17: 30,715,509	F1489L	possibly damaging	Het
Dopey2	A	T	16: 93,770,437	T1251S	probably benign	Het
Dtx2	G	A	5: 136,029,103	G421R	probably damaging	Het
Dusp27	C	A	1: 166,099,101	V981L	probably benign	Het
Epb41l3	T	A	17: 69,247,659	D251E	probably benign	Het
Erg	A	C	16: 95,360,983	Y305*	probably null	Het
Exosc4	G	A	15: 76,329,566	A197T	probably benign	Het
Fam227b	T	A	2: 126,100,909	I323L	probably benign	Het
Far1	G	T	7: 113,554,296		probably benign	Het
Fmod	A	G	1: 134,041,196	I325V	possibly damaging	Het
Fshr	C	G	17: 89,009,285	S169T	probably benign	Het
Gm17359	T	A	3: 79,405,786	W56R	probably damaging	Het
Gm17660	C	A	5: 104,074,881	G24*	probably null	Het
Gm4076	G	T	13: 85,127,226		noncoding transcript	Het
Gm5134	A	T	10: 75,992,525	Y313F	probably benign	Het
H2-Q6	T	A	17: 35,425,203	F54I	probably damaging	Het
Hcrtr2	C	A	9: 76,254,672	L145F	probably damaging	Het
Hepacam2	A	G	6: 3,476,121	L268P	probably damaging	Het
Herc2	C	A	7: 56,184,369	C3107*	probably null	Het
Herc4	T	C	10: 63,264,032	V78A	probably damaging	Het
Hyal5	T	C	6: 24,877,921	W339R	probably damaging	Het
Igfbp6	T	A	15: 102,147,984		probably null	Het
Il18rap	A	T	1: 40,525,058	H112L	probably benign	Het
Il1r2	T	A	1: 40,123,149	Y317*	probably null	Het
Ints8	C	A	4: 11,246,097	V190L	probably benign	Het
Ipo11	T	C	13: 106,925,087	T22A	probably benign	Het
Itgb4	C	A	11: 115,979,695	R117S	probably benign	Het
Lcorl	C	G	5: 45,734,369	G214A	probably benign	Het
Lgals3bp	T	A	11: 118,398,193		probably null	Het
Lyst	T	A	13: 13,616,713	L54I	probably damaging	Het
Mcm9	T	C	10: 53,538,154	T1015A	probably benign	Het
Mef2d	T	A	3: 88,156,518	I84N	probably damaging	Het
Mmrn2	A	G	14: 34,397,956	N261S	probably damaging	Het
Mpdz	T	C	4: 81,292,531	T1693A	probably benign	Het
Mss51	T	A	14: 20,484,688	Q338L	possibly damaging	Het
Mstn	T	A	1: 53,063,984	Y160N	probably damaging	Het
Muc6	T	C	7: 141,640,468	T1431A	probably benign	Het
Nek9	A	T	12: 85,301,883	M959K	probably benign	Het
Odf3l2	T	C	10: 79,640,265	D155G	probably damaging	Het
Olfr1311	A	T	2: 112,021,432	C141S	probably damaging	Het
Olfr319	G	A	11: 58,702,243	V181I	probably benign	Het
Olfr911-ps1	A	T	9: 38,524,505	M258L	probably benign	Het
Otog	G	T	7: 46,273,832	G1044W	probably damaging	Het
Pcdh9	G	A	14: 93,886,235	T833M	probably damaging	Het
Pdcd10	T	C	3: 75,527,651	K111R	probably damaging	Het
Pde5a	A	G	3: 122,748,458	N199S	probably damaging	Het
Plekhg1	T	C	10: 3,937,971	V355A	probably damaging	Het
Podn	G	T	4: 108,021,594	L359I	probably damaging	Het
Psd	T	C	19: 46,322,161	E483G	probably damaging	Het
Ptch2	T	A	4: 117,111,143	L905*	probably null	Het
Rxfp2	T	A	5: 150,066,415	N420K	probably damaging	Het
Sde2	T	A	1: 180,862,427	D237E	probably benign	Het
Serpina1d	A	T	12: 103,765,757	L281Q	probably damaging	Het
Serpina9	T	C	12: 104,001,470	N222S	probably benign	Het
Sh3bgrl2	A	G	9: 83,577,559	K57E	probably damaging	Het
Shc3	C	T	13: 51,480,228		probably benign	Het
Sik3	T	C	9: 46,208,740	M659T	possibly damaging	Het
Slc23a2	A	G	2: 132,072,017	L280P	probably damaging	Het
Smchd1	G	T	17: 71,387,088	Q1221K	probably benign	Het
Spocd1	A	G	4: 129,955,470	N694S	possibly damaging	Het
Tecta	T	C	9: 42,352,063	D1409G	probably damaging	Het
Tmem131	A	T	1: 36,841,673	V172D	probably damaging	Het
Trpm3	T	C	19: 22,986,873	M1244T	possibly damaging	Het
Usp17le	T	C	7: 104,768,501	N478S	probably benign	Het
Usp36	A	G	11: 118,273,571	V205A	probably damaging	Het
Vmn1r25	T	A	6: 57,978,509	Q265L	probably damaging	Het
Vwf	A	T	6: 125,638,114	H1176L	probably benign	Het
Zfyve28	C	T	5: 34,232,206	D217N	possibly damaging	Het
Zranb3	A	C	1: 127,955,080		probably null	Het

Other mutations in Ugcg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01447:Ugcg	APN	4	59213865	missense	possibly damaging	0.94
IGL01768:Ugcg	APN	4	59217216	critical splice donor site	probably null
IGL02636:Ugcg	APN	4	59207763	missense	possibly damaging	0.73
IGL02672:Ugcg	APN	4	59218587	splice site	probably benign
IGL02798:Ugcg	APN	4	59220346	missense	probably damaging	1.00
congee	UTSW	4	59207798	missense	probably benign	0.17
cream_o_wheat	UTSW	4	59220387	missense	possibly damaging	0.91
gruel	UTSW	4	59189690	missense	probably benign
Porridge	UTSW	4	59219530	missense	possibly damaging	0.86
slop	UTSW	4	59211883	missense	probably benign	0.16
wheatina	UTSW	4	59220272	missense	probably damaging	0.96
PIT4382001:Ugcg	UTSW	4	59213246	missense	possibly damaging	0.68
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0119:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0230:Ugcg	UTSW	4	59189739	nonsense	probably null
R0299:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0384:Ugcg	UTSW	4	59220387	missense	possibly damaging	0.91
R0645:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0688:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0726:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0802:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0803:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0811:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0812:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0828:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0831:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0944:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0945:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0947:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1104:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1209:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1210:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1252:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1253:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1255:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1488:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1490:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1548:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1698:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1771:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1776:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1781:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1794:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1840:Ugcg	UTSW	4	59219517	missense	probably damaging	1.00
R1942:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2228:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2229:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2237:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2239:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2314:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2338:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2340:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2422:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2426:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2433:Ugcg	UTSW	4	59207876	missense	possibly damaging	0.89
R2680:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3076:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3078:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3689:Ugcg	UTSW	4	59211883	missense	probably benign	0.16
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3733:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3766:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3767:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3768:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3769:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3771:Ugcg	UTSW	4	59189690	missense	probably benign
R3847:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3848:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3916:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3917:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3958:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3959:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4023:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4024:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4025:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4065:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4066:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4427:Ugcg	UTSW	4	59219555	missense	probably benign	0.02
R5842:Ugcg	UTSW	4	59219545	missense	possibly damaging	0.93
R6012:Ugcg	UTSW	4	59220272	missense	probably damaging	0.96
R6080:Ugcg	UTSW	4	59218524	missense	possibly damaging	0.70
R6762:Ugcg	UTSW	4	59219530	missense	possibly damaging	0.86
R7194:Ugcg	UTSW	4	59213210	missense	probably damaging	0.99
R7286:Ugcg	UTSW	4	59217111	missense	possibly damaging	0.95
R7362:Ugcg	UTSW	4	59217109	missense	probably damaging	1.00
R7472:Ugcg	UTSW	4	59217156	missense	probably benign
R7638:Ugcg	UTSW	4	59220299	missense	probably benign	0.26
R7866:Ugcg	UTSW	4	59211927	missense	possibly damaging	0.71
R8170:Ugcg	UTSW	4	59211974	missense	possibly damaging	0.71
R8488:Ugcg	UTSW	4	59213896	missense	probably benign	0.00
R8793:Ugcg	UTSW	4	59207794	missense	probably benign	0.22
Y4336:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
Y4337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GGGTAGTCAGCCAGACAAATCACTG -3'
(R):5'- GCGAATGCTCTGCCAAAATTACTAACC -3'

Sequencing Primer
(F):5'- TGCCCGAACTACAGTAGCG -3'
(R):5'- GCCAATTGAATTTGCTGGATACTG -3'

Posted On

2013-06-12