Incidental Mutation 'R5168:Cntrob'
ID 470011
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 042748-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R5168 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69190816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 849 (I849F)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
AlphaFold Q8CB62
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: I849F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: I849F

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect unknown
Transcript: ENSMUST00000130780
AA Change: R45S
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782
AA Change: R45S

DomainStartEndE-ValueType
low complexity region 50 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156671
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 (GRCm39) N478D probably benign Het
Acsl1 T A 8: 46,966,303 (GRCm39) probably benign Het
Aox1 T A 1: 58,088,561 (GRCm39) C116S probably damaging Het
Bag6 T C 17: 35,363,671 (GRCm39) L785P probably damaging Het
Calcr T C 6: 3,708,610 (GRCm39) N192S probably benign Het
Cntrl T A 2: 35,047,667 (GRCm39) L1414H probably damaging Het
Col6a3 C T 1: 90,701,361 (GRCm39) W2518* probably null Het
Cxcl15 T A 5: 90,943,142 (GRCm39) I48K probably damaging Het
Dab2 T C 15: 6,365,924 (GRCm39) probably benign Het
Ddx54 A G 5: 120,755,097 (GRCm39) E82G probably benign Het
Dock1 T C 7: 134,720,637 (GRCm39) W1249R probably damaging Het
Fras1 A C 5: 96,856,616 (GRCm39) M2000L probably benign Het
Gpr31b A T 17: 13,270,326 (GRCm39) I281N probably damaging Het
Gvin3 T C 7: 106,196,054 (GRCm39) noncoding transcript Het
Haus5 T C 7: 30,357,136 (GRCm39) T432A possibly damaging Het
Hecw2 A G 1: 53,952,459 (GRCm39) S925P probably damaging Het
Katnal1 A G 5: 148,858,132 (GRCm39) M26T possibly damaging Het
Mccc1 C T 3: 36,044,929 (GRCm39) W71* probably null Het
Muc6 G A 7: 141,223,981 (GRCm39) probably benign Het
Nrbp1 T A 5: 31,407,481 (GRCm39) V397D probably damaging Het
Nt5dc1 T A 10: 34,273,236 (GRCm39) E187D probably benign Het
Or1e19 T A 11: 73,316,669 (GRCm39) I47F probably benign Het
Or51f23 C T 7: 102,453,528 (GRCm39) A281V probably benign Het
Polr1c G T 17: 46,558,635 (GRCm39) probably benign Het
Pramel27 T C 4: 143,579,768 (GRCm39) V451A probably benign Het
Ralgapa1 A G 12: 55,804,817 (GRCm39) V493A probably benign Het
Ryr2 T C 13: 11,767,207 (GRCm39) T1228A probably benign Het
Slc26a3 G A 12: 31,518,553 (GRCm39) V674I possibly damaging Het
Spata31f1a C T 4: 42,851,488 (GRCm39) V223I probably damaging Het
Srp68 C A 11: 116,156,300 (GRCm39) E147D probably damaging Het
Tacr3 T C 3: 134,535,320 (GRCm39) I96T probably damaging Het
Tmem236 T C 2: 14,197,139 (GRCm39) probably null Het
Tmem62 T A 2: 120,824,088 (GRCm39) N254K probably benign Het
Tmem79 A T 3: 88,240,651 (GRCm39) L99Q probably damaging Het
Trav6-5 A T 14: 53,728,973 (GRCm39) N78Y probably benign Het
Trim33 C T 3: 103,248,997 (GRCm39) Q807* probably null Het
Ugt1a10 A G 1: 87,983,531 (GRCm39) T110A probably benign Het
Vcl C T 14: 21,060,170 (GRCm39) T603I probably damaging Het
Vps8 A T 16: 21,276,195 (GRCm39) T243S probably damaging Het
Vps8 A C 16: 21,351,849 (GRCm39) I323L probably benign Het
Zfp746 G C 6: 48,041,329 (GRCm39) Q465E possibly damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATTCCTCTGAGACAGACAGAATG -3'
(R):5'- CTACTCAGGGTCTGCACTTG -3'

Sequencing Primer
(F):5'- TGCAGGGCACTAATTAAAATGAATG -3'
(R):5'- CAGGGTCTGCACTTGCTCTG -3'
Posted On 2017-03-06