Incidental Mutation 'R0499:Ptch2'
ID 47004
Institutional Source Beutler Lab
Gene Symbol Ptch2
Ensembl Gene ENSMUSG00000028681
Gene Name patched 2
Synonyms ptc2
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0499 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 117096075-117116101 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 117111143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 905 (L905*)
Ref Sequence ENSEMBL: ENSMUSP00000030443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030443] [ENSMUST00000144620]
AlphaFold O35595
Predicted Effect probably null
Transcript: ENSMUST00000030443
AA Change: L905*
SMART Domains Protein: ENSMUSP00000030443
Gene: ENSMUSG00000028681
AA Change: L905*

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Pfam:Patched 338 831 1.6e-42 PFAM
Pfam:Sterol-sensing 418 570 9.5e-49 PFAM
Pfam:Patched 901 1116 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135133
Predicted Effect probably benign
Transcript: ENSMUST00000137209
SMART Domains Protein: ENSMUSP00000114461
Gene: ENSMUSG00000028681

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144620
SMART Domains Protein: ENSMUSP00000122548
Gene: ENSMUSG00000028681

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156989
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: This gene encodes a member of the patched family of transmembrane receptor proteins. The encoded protein may be a functional receptor for the morphogen sonic hedgehog (Shh) and is reportedly involved in limb and skin development. Homozygous mutant mice for this gene exhibit hair loss and epidermal hyperplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Male mice homozygous for a targeted gene disruption display anemia, abnormal red blood cells, enlarged spleens, extramedullary hematopoiesis, and an increased percentage of neutrophils. Most male mice homozygous for another allele display alopecia and skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Ptch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Ptch2 APN 4 117114082 missense probably damaging 1.00
IGL01684:Ptch2 APN 4 117104787 missense probably damaging 1.00
IGL01967:Ptch2 APN 4 117114233 splice site probably benign
IGL02449:Ptch2 APN 4 117108183 missense possibly damaging 0.79
IGL02488:Ptch2 APN 4 117110396 missense probably damaging 0.99
IGL02935:Ptch2 APN 4 117114770 missense probably damaging 1.00
R0103:Ptch2 UTSW 4 117109425 splice site probably benign
R0326:Ptch2 UTSW 4 117108884 missense probably damaging 1.00
R0403:Ptch2 UTSW 4 117110839 nonsense probably null
R0550:Ptch2 UTSW 4 117096433 splice site probably benign
R0565:Ptch2 UTSW 4 117106143 splice site probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1484:Ptch2 UTSW 4 117110849 missense probably damaging 0.97
R1920:Ptch2 UTSW 4 117108661 missense probably benign 0.09
R4080:Ptch2 UTSW 4 117111206 missense probably damaging 1.00
R4611:Ptch2 UTSW 4 117110378 missense probably benign 0.24
R5117:Ptch2 UTSW 4 117105949 missense probably damaging 1.00
R5240:Ptch2 UTSW 4 117106138 splice site probably benign
R5936:Ptch2 UTSW 4 117108294 missense probably benign 0.39
R5987:Ptch2 UTSW 4 117110057 missense probably benign 0.13
R6155:Ptch2 UTSW 4 117096908 missense probably damaging 1.00
R7158:Ptch2 UTSW 4 117114784 missense possibly damaging 0.76
R7196:Ptch2 UTSW 4 117114749 missense probably benign 0.23
R7346:Ptch2 UTSW 4 117114652 missense probably benign 0.40
R7380:Ptch2 UTSW 4 117114646 missense possibly damaging 0.92
R7547:Ptch2 UTSW 4 117109964 missense probably damaging 1.00
R7600:Ptch2 UTSW 4 117096225 start gained probably benign
R7731:Ptch2 UTSW 4 117108295 missense probably benign 0.09
R7836:Ptch2 UTSW 4 117105027 splice site probably null
R7874:Ptch2 UTSW 4 117105964 missense possibly damaging 0.83
R7881:Ptch2 UTSW 4 117110388 missense probably benign
R7942:Ptch2 UTSW 4 117106001 missense probably benign 0.01
R8426:Ptch2 UTSW 4 117108172 missense possibly damaging 0.84
R8715:Ptch2 UTSW 4 117111522 missense probably damaging 0.98
R8759:Ptch2 UTSW 4 117110433 missense probably damaging 0.99
R9082:Ptch2 UTSW 4 117105100 critical splice donor site probably null
R9276:Ptch2 UTSW 4 117110308 missense probably damaging 0.97
R9336:Ptch2 UTSW 4 117097000 missense probably damaging 1.00
R9336:Ptch2 UTSW 4 117109579 missense possibly damaging 0.89
R9368:Ptch2 UTSW 4 117104772 missense probably damaging 0.98
X0019:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0024:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0025:Ptch2 UTSW 4 117096986 missense probably damaging 1.00
X0035:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0038:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0039:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0040:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0052:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0053:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0054:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0061:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CGACAAATATGATACCACCGGGGAG -3'
(R):5'- TCATCATTGCCAGGACCAGCAC -3'

Sequencing Primer
(F):5'- AGAACCTTCGCAGTGAGTC -3'
(R):5'- AGATGCAGACTGCCAGC -3'
Posted On 2013-06-12