Mutagenetix > Incidental Mutations

Incidental Mutation 'R4375:Zfr'

470058

Institutional Source

Beutler Lab

Gene Symbol

Zfr

Ensembl Gene

ENSMUSG00000022201

Gene Name

zinc finger RNA binding protein

Synonyms

MMRRC Submission

041119-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4375 (G1)

Quality Score

187

Status

Not validated

Chromosome

Chromosomal Location

12117831-12185683 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 12118340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122941] [ENSMUST00000128475] [ENSMUST00000134277]

AlphaFold

O88532

Predicted Effect

probably null
Transcript: ENSMUST00000122941

SMART Domains

Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	69	116	N/A	INTRINSIC
low complexity region	159	182	N/A	INTRINSIC
low complexity region	196	224	N/A	INTRINSIC
low complexity region	229	302	N/A	INTRINSIC
ZnF_U1	328	362	7.79e-6	SMART
ZnF_C2H2	331	355	4.94e0	SMART
ZnF_U1	379	413	1.84e-7	SMART
ZnF_C2H2	382	406	4.65e-1	SMART
low complexity region	429	448	N/A	INTRINSIC
low complexity region	468	483	N/A	INTRINSIC
ZnF_U1	579	613	2.01e-8	SMART
ZnF_C2H2	582	606	1.31e0	SMART
low complexity region	630	664	N/A	INTRINSIC
low complexity region	685	719	N/A	INTRINSIC
low complexity region	766	782	N/A	INTRINSIC
DZF	784	1038	5.42e-170	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124621

Predicted Effect

probably benign
Transcript: ENSMUST00000128475

SMART Domains

Protein: ENSMUSP00000117207
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	32	79	N/A	INTRINSIC
low complexity region	122	145	N/A	INTRINSIC
low complexity region	159	187	N/A	INTRINSIC
low complexity region	192	247	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134277

SMART Domains

Protein: ENSMUSP00000119917
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	78	125	N/A	INTRINSIC
low complexity region	168	191	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228196

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adhfe1	A	T	1: 9,561,628		probably benign	Het
C330007P06Rik	C	A	X: 36,824,159	C206F	probably benign	Het
Cd209c	T	C	8: 3,954,635		noncoding transcript	Het
Cntnap1	A	G	11: 101,182,253	D561G	probably damaging	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Cyp4b1	T	C	4: 115,636,313	T191A	probably benign	Het
Dapk1	A	T	13: 60,761,589	M1339L	probably benign	Het
Dpm3	T	C	3: 89,266,908	Y59H	probably damaging	Het
Eif2ak4	A	G	2: 118,427,924	Y585C	probably damaging	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Fam184b	T	C	5: 45,542,343	D577G	probably benign	Het
Gon4l	C	A	3: 88,907,387	P1888T	probably benign	Het
Hsf2bp	C	T	17: 31,987,348	D270N	probably null	Het
Lactbl1	T	C	4: 136,637,591	V418A	possibly damaging	Het
Lifr	A	T	15: 7,166,898	M188L	probably benign	Het
Ltbp1	G	T	17: 75,312,997	G760V	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Nlrp12	A	G	7: 3,240,946	L312P	possibly damaging	Het
Olfr365	T	A	2: 37,201,562	M107K	probably benign	Het
Olfr608	T	C	7: 103,470,071	S11P	probably damaging	Het
Olfr898	T	C	9: 38,349,169	F23L	probably benign	Het
Pcdh17	T	C	14: 84,448,271	V726A	possibly damaging	Het
Pdia4	G	A	6: 47,798,392	R495W	probably damaging	Het
Phf20l1	T	C	15: 66,615,222	S369P	probably benign	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prcc	A	G	3: 87,867,407	Y363H	probably damaging	Het
Proser3	A	G	7: 30,540,671	V336A	possibly damaging	Het
Rbbp8	C	T	18: 11,725,410	T646M	probably benign	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Snx9	G	A	17: 5,908,626	W292*	probably null	Het
St14	T	C	9: 31,090,458	I784V	probably benign	Het
Strc	A	G	2: 121,380,823	S14P	unknown	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Ubap1	G	A	4: 41,371,850		probably null	Het

Other mutations in Zfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Zfr	APN	15	12159646	missense	probably benign	0.26
IGL01759:Zfr	APN	15	12159655	missense	probably damaging	0.99
IGL01935:Zfr	APN	15	12180712	missense	probably benign	0.42
IGL02056:Zfr	APN	15	12154447	missense	probably damaging	1.00
IGL03009:Zfr	APN	15	12162235	missense	probably damaging	1.00
IGL03147:Zfr	UTSW	15	12140552	nonsense	probably null
PIT4504001:Zfr	UTSW	15	12166158	missense	possibly damaging	0.48
R0377:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R0678:Zfr	UTSW	15	12184085	missense	probably damaging	1.00
R0783:Zfr	UTSW	15	12162182	missense	probably damaging	1.00
R0787:Zfr	UTSW	15	12140548	missense	unknown
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1538:Zfr	UTSW	15	12150243	missense	possibly damaging	0.61
R1558:Zfr	UTSW	15	12140644	missense	unknown
R1619:Zfr	UTSW	15	12150387	missense	possibly damaging	0.52
R1924:Zfr	UTSW	15	12160629	missense	possibly damaging	0.74
R2163:Zfr	UTSW	15	12162223	missense	probably damaging	1.00
R2958:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2960:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2961:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2962:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2963:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R3012:Zfr	UTSW	15	12166163	missense	probably damaging	1.00
R3054:Zfr	UTSW	15	12154507	missense	probably damaging	1.00
R3429:Zfr	UTSW	15	12152920	missense	probably benign	0.00
R3611:Zfr	UTSW	15	12159762	critical splice donor site	probably null
R3825:Zfr	UTSW	15	12166191	missense	probably damaging	1.00
R3882:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4080:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4241:Zfr	UTSW	15	12149659	missense	probably damaging	1.00
R4366:Zfr	UTSW	15	12156330	missense	probably damaging	0.99
R4893:Zfr	UTSW	15	12136542	missense	unknown
R4899:Zfr	UTSW	15	12166145	missense	probably benign	0.11
R4915:Zfr	UTSW	15	12162112	critical splice acceptor site	probably null
R5870:Zfr	UTSW	15	12160615	missense	probably damaging	1.00
R6162:Zfr	UTSW	15	12146245	missense	unknown
R6163:Zfr	UTSW	15	12146245	missense	unknown
R6165:Zfr	UTSW	15	12146245	missense	unknown
R6187:Zfr	UTSW	15	12146231	small deletion	probably benign
R6251:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R6903:Zfr	UTSW	15	12136455	missense	unknown
R6959:Zfr	UTSW	15	12150323	missense	probably damaging	1.00
R7133:Zfr	UTSW	15	12180638	missense	probably damaging	1.00
R7167:Zfr	UTSW	15	12180929	missense	probably benign	0.01
R7212:Zfr	UTSW	15	12146223	nonsense	probably null
R7373:Zfr	UTSW	15	12140559	missense	unknown
R7489:Zfr	UTSW	15	12152982	missense	probably benign	0.24
R7602:Zfr	UTSW	15	12159677	missense	possibly damaging	0.56
R7623:Zfr	UTSW	15	12160528	missense	possibly damaging	0.83
R7896:Zfr	UTSW	15	12146377	missense	probably damaging	1.00
R8188:Zfr	UTSW	15	12171818	missense	probably damaging	1.00
R8289:Zfr	UTSW	15	12135271	missense	noncoding transcript
R8382:Zfr	UTSW	15	12152968	nonsense	probably null
R8475:Zfr	UTSW	15	12150369	missense	probably benign	0.08
R9124:Zfr	UTSW	15	12136671	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TAAATGTGGCCCGTGGAGG -3'
(R):5'- GAGGCCATTTTACCTCCGGG -3'

Sequencing Primer
(F):5'- CCAGGGCGGCTTCTCAC -3'
(R):5'- ATTTTACCTCCGGGGCCGTC -3'

Posted On

2017-03-06