Incidental Mutation 'R4375:Zfr'
ID470058
Institutional Source Beutler Lab
Gene Symbol Zfr
Ensembl Gene ENSMUSG00000022201
Gene Namezinc finger RNA binding protein
Synonyms
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4375 (G1)
Quality Score187
Status Not validated
Chromosome15
Chromosomal Location12117831-12185683 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 12118340 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122941] [ENSMUST00000128475] [ENSMUST00000134277]
Predicted Effect probably null
Transcript: ENSMUST00000122941
SMART Domains Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201

DomainStartEndE-ValueType
low complexity region 69 116 N/A INTRINSIC
low complexity region 159 182 N/A INTRINSIC
low complexity region 196 224 N/A INTRINSIC
low complexity region 229 302 N/A INTRINSIC
ZnF_U1 328 362 7.79e-6 SMART
ZnF_C2H2 331 355 4.94e0 SMART
ZnF_U1 379 413 1.84e-7 SMART
ZnF_C2H2 382 406 4.65e-1 SMART
low complexity region 429 448 N/A INTRINSIC
low complexity region 468 483 N/A INTRINSIC
ZnF_U1 579 613 2.01e-8 SMART
ZnF_C2H2 582 606 1.31e0 SMART
low complexity region 630 664 N/A INTRINSIC
low complexity region 685 719 N/A INTRINSIC
low complexity region 766 782 N/A INTRINSIC
DZF 784 1038 5.42e-170 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124621
Predicted Effect probably benign
Transcript: ENSMUST00000128475
SMART Domains Protein: ENSMUSP00000117207
Gene: ENSMUSG00000022201

DomainStartEndE-ValueType
low complexity region 32 79 N/A INTRINSIC
low complexity region 122 145 N/A INTRINSIC
low complexity region 159 187 N/A INTRINSIC
low complexity region 192 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134277
SMART Domains Protein: ENSMUSP00000119917
Gene: ENSMUSG00000022201

DomainStartEndE-ValueType
low complexity region 78 125 N/A INTRINSIC
low complexity region 168 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228196
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Other mutations in Zfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Zfr APN 15 12159646 missense probably benign 0.26
IGL01759:Zfr APN 15 12159655 missense probably damaging 0.99
IGL01935:Zfr APN 15 12180712 missense probably benign 0.42
IGL02056:Zfr APN 15 12154447 missense probably damaging 1.00
IGL03009:Zfr APN 15 12162235 missense probably damaging 1.00
IGL03147:Zfr UTSW 15 12140552 nonsense probably null
PIT4504001:Zfr UTSW 15 12166158 missense possibly damaging 0.48
R0377:Zfr UTSW 15 12160591 missense probably benign 0.02
R0678:Zfr UTSW 15 12184085 missense probably damaging 1.00
R0783:Zfr UTSW 15 12162182 missense probably damaging 1.00
R0787:Zfr UTSW 15 12140548 missense unknown
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1538:Zfr UTSW 15 12150243 missense possibly damaging 0.61
R1558:Zfr UTSW 15 12140644 missense unknown
R1619:Zfr UTSW 15 12150387 missense possibly damaging 0.52
R1924:Zfr UTSW 15 12160629 missense possibly damaging 0.74
R2163:Zfr UTSW 15 12162223 missense probably damaging 1.00
R2958:Zfr UTSW 15 12162233 missense probably benign 0.08
R2960:Zfr UTSW 15 12162233 missense probably benign 0.08
R2961:Zfr UTSW 15 12162233 missense probably benign 0.08
R2962:Zfr UTSW 15 12162233 missense probably benign 0.08
R2963:Zfr UTSW 15 12162233 missense probably benign 0.08
R3012:Zfr UTSW 15 12166163 missense probably damaging 1.00
R3054:Zfr UTSW 15 12154507 missense probably damaging 1.00
R3429:Zfr UTSW 15 12152920 missense probably benign 0.00
R3611:Zfr UTSW 15 12159762 critical splice donor site probably null
R3825:Zfr UTSW 15 12166191 missense probably damaging 1.00
R3882:Zfr UTSW 15 12162233 missense probably benign 0.08
R4080:Zfr UTSW 15 12162233 missense probably benign 0.08
R4241:Zfr UTSW 15 12149659 missense probably damaging 1.00
R4366:Zfr UTSW 15 12156330 missense probably damaging 0.99
R4893:Zfr UTSW 15 12136542 missense unknown
R4899:Zfr UTSW 15 12166145 missense probably benign 0.11
R4915:Zfr UTSW 15 12162112 critical splice acceptor site probably null
R5870:Zfr UTSW 15 12160615 missense probably damaging 1.00
R6162:Zfr UTSW 15 12146245 missense unknown
R6163:Zfr UTSW 15 12146245 missense unknown
R6165:Zfr UTSW 15 12146245 missense unknown
R6187:Zfr UTSW 15 12146231 small deletion probably benign
R6251:Zfr UTSW 15 12160591 missense probably benign 0.02
R6903:Zfr UTSW 15 12136455 missense unknown
R6959:Zfr UTSW 15 12150323 missense probably damaging 1.00
R7133:Zfr UTSW 15 12180638 missense probably damaging 1.00
R7167:Zfr UTSW 15 12180929 missense probably benign 0.01
R7212:Zfr UTSW 15 12146223 nonsense probably null
R7373:Zfr UTSW 15 12140559 missense unknown
R7489:Zfr UTSW 15 12152982 missense probably benign 0.24
R7602:Zfr UTSW 15 12159677 missense possibly damaging 0.56
R7623:Zfr UTSW 15 12160528 missense possibly damaging 0.83
R7896:Zfr UTSW 15 12146377 missense probably damaging 1.00
R7979:Zfr UTSW 15 12146377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAATGTGGCCCGTGGAGG -3'
(R):5'- GAGGCCATTTTACCTCCGGG -3'

Sequencing Primer
(F):5'- CCAGGGCGGCTTCTCAC -3'
(R):5'- ATTTTACCTCCGGGGCCGTC -3'
Posted On2017-03-06