Incidental Mutation 'R0499:Otog'
ID47016
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R0499 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46273832 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 1044 (G1044W)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
Predicted Effect probably damaging
Transcript: ENSMUST00000164538
AA Change: G1044W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: G1044W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
R7577:Otog UTSW 7 46287855 missense possibly damaging 0.62
R7651:Otog UTSW 7 46241761 missense probably benign 0.00
R7689:Otog UTSW 7 46252056 missense probably damaging 1.00
R7806:Otog UTSW 7 46285776 missense probably benign
RF024:Otog UTSW 7 46287669 missense probably damaging 1.00
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTGAAACATTCCCTTAAAGTCCAC -3'
(R):5'- TAGTCAGTCCCTCAGCACCAAGTC -3'

Sequencing Primer
(F):5'- CTGTGCTCTTCATGGGACG -3'
(R):5'- ACCAAGTCTAACAGAAGTGGC -3'
Posted On2013-06-12