Incidental Mutation 'R0499:Ces1g'
ID47020
Institutional Source Beutler Lab
Gene Symbol Ces1g
Ensembl Gene ENSMUSG00000057074
Gene Namecarboxylesterase 1G
SynonymsSes-1, Ces1, Ces-1
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0499 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93302369-93337308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93333689 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 101 (F101L)
Ref Sequence ENSEMBL: ENSMUSP00000037555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044602]
Predicted Effect probably benign
Transcript: ENSMUST00000044602
AA Change: F101L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000037555
Gene: ENSMUSG00000057074
AA Change: F101L

DomainStartEndE-ValueType
Pfam:COesterase 1 545 3.6e-168 PFAM
Pfam:Abhydrolase_3 136 295 5.7e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. The expression and activity of this gene is age-related but independent of growth hormone level. This gene is clustered with Ces7 and Ces3 on chromosome 8. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Ces1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ces1g APN 8 93302987 missense possibly damaging 0.61
IGL00971:Ces1g APN 8 93303032 missense probably damaging 1.00
IGL01583:Ces1g APN 8 93306959 missense probably damaging 1.00
IGL02993:Ces1g APN 8 93317079 missense probably benign 0.00
IGL03386:Ces1g APN 8 93325812 missense probably benign 0.00
R0359:Ces1g UTSW 8 93328535 splice site probably benign
R0373:Ces1g UTSW 8 93331193 missense probably benign 0.06
R0689:Ces1g UTSW 8 93328407 missense probably damaging 1.00
R1756:Ces1g UTSW 8 93306954 missense probably benign 0.03
R3052:Ces1g UTSW 8 93335048 missense possibly damaging 0.50
R3150:Ces1g UTSW 8 93325816 missense probably benign 0.45
R3899:Ces1g UTSW 8 93303050 missense probably damaging 1.00
R3966:Ces1g UTSW 8 93328511 missense possibly damaging 0.50
R4134:Ces1g UTSW 8 93319872 missense probably benign 0.00
R4198:Ces1g UTSW 8 93305868 missense probably benign 0.11
R4332:Ces1g UTSW 8 93319818 missense probably benign 0.01
R4719:Ces1g UTSW 8 93317090 missense possibly damaging 0.59
R4841:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4842:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4843:Ces1g UTSW 8 93331265 missense probably damaging 1.00
R5344:Ces1g UTSW 8 93337193 start gained probably benign
R5405:Ces1g UTSW 8 93305868 missense probably benign 0.29
R5425:Ces1g UTSW 8 93325800 missense probably benign 0.20
R5884:Ces1g UTSW 8 93306930 missense probably benign 0.24
R6022:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R6183:Ces1g UTSW 8 93331239 missense possibly damaging 0.48
R6197:Ces1g UTSW 8 93337136 missense probably benign 0.01
R6307:Ces1g UTSW 8 93331192 missense possibly damaging 0.60
R6688:Ces1g UTSW 8 93306972 missense possibly damaging 0.92
R6863:Ces1g UTSW 8 93317019 missense possibly damaging 0.92
R7097:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7122:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7180:Ces1g UTSW 8 93302948 missense probably benign 0.04
R7202:Ces1g UTSW 8 93302967 missense probably benign 0.01
R7361:Ces1g UTSW 8 93333679 missense not run
R7537:Ces1g UTSW 8 93319827 missense probably benign 0.01
R7621:Ces1g UTSW 8 93328466 missense probably damaging 1.00
R8200:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R8895:Ces1g UTSW 8 93319884 missense possibly damaging 0.83
Z1176:Ces1g UTSW 8 93325811 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTTCTCAGAATCAGGGCGGTCTC -3'
(R):5'- CTGTATTGAAGGACAGGCCAGCATC -3'

Sequencing Primer
(F):5'- CTTAAGTCCTGGACTGTGAAGAC -3'
(R):5'- GCATTAGAGAAGTCAAAGTTTCCCC -3'
Posted On2013-06-12