Incidental Mutation 'R4543:Gm3604'
ID470206
Institutional Source Beutler Lab
Gene Symbol Gm3604
Ensembl Gene ENSMUSG00000094942
Gene Namepredicted gene 3604
Synonyms
MMRRC Submission 041778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4543 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location62368328-62383177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62370156 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 109 (D109G)
Ref Sequence ENSEMBL: ENSMUSP00000144048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107989] [ENSMUST00000187656] [ENSMUST00000202194]
Predicted Effect silent
Transcript: ENSMUST00000107989
SMART Domains Protein: ENSMUSP00000103623
Gene: ENSMUSG00000094942

DomainStartEndE-ValueType
KRAB 3 65 4.49e-17 SMART
ZnF_C2H2 132 154 2.71e-2 SMART
ZnF_C2H2 160 182 1.3e-4 SMART
ZnF_C2H2 188 210 5.21e-4 SMART
ZnF_C2H2 216 238 1.82e-3 SMART
ZnF_C2H2 244 266 7.78e-3 SMART
ZnF_C2H2 272 294 3.69e-4 SMART
ZnF_C2H2 300 322 3.95e-4 SMART
ZnF_C2H2 328 350 9.08e-4 SMART
ZnF_C2H2 356 378 1.45e-2 SMART
ZnF_C2H2 384 406 1.92e-2 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 1.4e-4 SMART
ZnF_C2H2 496 518 3.95e-4 SMART
ZnF_C2H2 524 546 2.29e1 SMART
Predicted Effect silent
Transcript: ENSMUST00000187656
SMART Domains Protein: ENSMUSP00000139845
Gene: ENSMUSG00000094942

DomainStartEndE-ValueType
KRAB 4 66 1.9e-19 SMART
ZnF_C2H2 133 155 1.2e-4 SMART
ZnF_C2H2 161 183 5.5e-7 SMART
ZnF_C2H2 189 211 2.3e-6 SMART
ZnF_C2H2 217 239 7.5e-6 SMART
ZnF_C2H2 245 267 3.4e-5 SMART
ZnF_C2H2 273 295 1.5e-6 SMART
ZnF_C2H2 301 323 1.7e-6 SMART
ZnF_C2H2 329 351 3.7e-6 SMART
ZnF_C2H2 357 379 6.3e-5 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 5.5e-7 SMART
ZnF_C2H2 441 463 2e-6 SMART
ZnF_C2H2 469 491 5.8e-7 SMART
ZnF_C2H2 497 519 1.6e-6 SMART
ZnF_C2H2 525 547 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202194
AA Change: D109G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144048
Gene: ENSMUSG00000094942
AA Change: D109G

DomainStartEndE-ValueType
KRAB 4 65 1.2e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,389,793 M101K probably benign Het
A1bg A T 15: 60,917,900 S500T probably damaging Het
Abhd3 T C 18: 10,706,672 D2G possibly damaging Het
Ablim1 C T 19: 57,077,442 R366H possibly damaging Het
Adgre1 T A 17: 57,406,874 H186Q probably benign Het
Ankmy1 G T 1: 92,884,850 A579E probably damaging Het
Ap2b1 C A 11: 83,324,650 T140K probably damaging Het
Arhgef28 T A 13: 98,075,000 E158D probably benign Het
Atp8b4 A G 2: 126,358,066 F885L probably damaging Het
Barx2 A G 9: 31,846,796 L282S unknown Het
Catsper2 C T 2: 121,407,409 W163* probably null Het
Cep295 T C 9: 15,335,253 T588A possibly damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Clca3a1 T A 3: 144,746,988 Q578L probably damaging Het
Crp A C 1: 172,698,737 I130L probably benign Het
Dtwd2 C A 18: 49,724,108 probably null Het
Fads3 T C 19: 10,041,811 F27S possibly damaging Het
Gtf2ird1 A G 5: 134,363,900 probably null Het
H2-K1 C T 17: 33,999,558 probably null Het
Hdac5 T C 11: 102,213,944 probably benign Het
Il6st G A 13: 112,481,459 V136M probably damaging Het
Immt T C 6: 71,851,778 S106P probably damaging Het
Kat2b T C 17: 53,653,140 I492T probably benign Het
Kcnn2 T C 18: 45,559,648 F97S probably benign Het
Kdm4c A G 4: 74,330,760 I84V probably benign Het
Kif7 G A 7: 79,707,548 P637S probably benign Het
Lrrcc1 T A 3: 14,539,791 I109K probably damaging Het
Med12l T A 3: 59,091,508 C619S probably damaging Het
Olfr919 A G 9: 38,697,545 S274P possibly damaging Het
Polq T C 16: 37,060,785 C1104R probably benign Het
Rbfox2 A T 15: 77,306,368 M59K probably benign Het
Rft1 T C 14: 30,661,333 V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Slc2a12 T A 10: 22,664,786 V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,235,136 probably benign Het
Stap2 C T 17: 55,997,604 probably null Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tmem132c A G 5: 127,504,977 T419A probably benign Het
Tmprss11a G A 5: 86,411,809 Q375* probably null Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,622,236 probably null Het
Vmn1r88 T A 7: 13,177,980 S88T possibly damaging Het
Zfp622 T A 15: 25,991,537 D143E possibly damaging Het
Other mutations in Gm3604
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Gm3604 APN 13 62370140 missense probably damaging 1.00
IGL02601:Gm3604 APN 13 62370176 missense possibly damaging 0.79
IGL03386:Gm3604 APN 13 62370167 missense possibly damaging 0.95
R1539:Gm3604 UTSW 13 62371600 missense possibly damaging 0.70
R1771:Gm3604 UTSW 13 62370074 nonsense probably null
R1776:Gm3604 UTSW 13 62370074 nonsense probably null
R1919:Gm3604 UTSW 13 62369942 missense probably benign 0.02
R1954:Gm3604 UTSW 13 62369211 missense probably damaging 0.97
R2093:Gm3604 UTSW 13 62369606 missense possibly damaging 0.50
R2291:Gm3604 UTSW 13 62371843 missense probably damaging 0.99
R2909:Gm3604 UTSW 13 62369018 missense probably benign 0.43
R3195:Gm3604 UTSW 13 62370054 nonsense probably null
R3196:Gm3604 UTSW 13 62370054 nonsense probably null
R3924:Gm3604 UTSW 13 62370230 missense probably damaging 0.99
R4328:Gm3604 UTSW 13 62369265 missense possibly damaging 0.88
R4830:Gm3604 UTSW 13 62369043 missense probably damaging 0.98
R5129:Gm3604 UTSW 13 62369774 missense probably benign 0.00
R5496:Gm3604 UTSW 13 62371579 missense possibly damaging 0.85
R6184:Gm3604 UTSW 13 62371845 missense probably damaging 1.00
R6426:Gm3604 UTSW 13 62369622 missense probably damaging 1.00
R6925:Gm3604 UTSW 13 62369390 missense probably benign 0.16
R7080:Gm3604 UTSW 13 62370295 missense probably damaging 1.00
R7182:Gm3604 UTSW 13 62371875 missense probably damaging 0.99
R7572:Gm3604 UTSW 13 62370246 missense probably damaging 1.00
R7750:Gm3604 UTSW 13 62369996 missense possibly damaging 0.92
R8023:Gm3604 UTSW 13 62369869 missense probably damaging 1.00
R8062:Gm3604 UTSW 13 62370341 missense probably damaging 0.98
Predicted Primers
Posted On2017-03-07