Incidental Mutation 'R4674:Rttn'
ID470292
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Namerotatin
SynonymsC530033I08Rik, 4921538A15Rik
MMRRC Submission 041929-MU
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4674 (G1)
Quality Score214
Status Not validated
Chromosome18
Chromosomal Location88971790-89131013 bp(+) (GRCm38)
Type of Mutationintron (47 bp from exon)
DNA Base Change (assembly) T to A at 89011011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
Predicted Effect probably null
Transcript: ENSMUST00000023828
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 intron probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGTCTCTGAATGGTTTAATTTCC -3'
(R):5'- GCTAACTAGTTTAATGCAGCTAGC -3'

Sequencing Primer
(F):5'- ATTAGTGGAGCTGGCAGA -3'
(R):5'- TGTCAGATCCCCTGGAATAGG -3'
Posted On2017-03-08