Incidental Mutation 'R0499:Olfr319'
ID47036
Institutional Source Beutler Lab
Gene Symbol Olfr319
Ensembl Gene ENSMUSG00000064044
Gene Nameolfactory receptor 319
SynonymsMOR285-2, GA_x6K02T2NKPP-708319-707399
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0499 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58699162-58703472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58702243 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 181 (V181I)
Ref Sequence ENSEMBL: ENSMUSP00000150883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076965] [ENSMUST00000215962]
Predicted Effect probably benign
Transcript: ENSMUST00000076965
AA Change: V181I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000076232
Gene: ENSMUSG00000064044
AA Change: V181I

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.8e-46 PFAM
Pfam:7tm_1 41 290 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215238
Predicted Effect probably benign
Transcript: ENSMUST00000215962
AA Change: V181I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.1342 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Olfr319
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Olfr319 APN 11 58701767 missense probably benign
IGL01955:Olfr319 APN 11 58702129 missense probably damaging 0.97
IGL02145:Olfr319 APN 11 58702060 missense probably damaging 0.99
IGL02283:Olfr319 APN 11 58702276 missense probably damaging 0.96
R0468:Olfr319 UTSW 11 58701793 missense probably damaging 1.00
R0815:Olfr319 UTSW 11 58702609 missense possibly damaging 0.84
R0885:Olfr319 UTSW 11 58702087 missense possibly damaging 0.93
R1081:Olfr319 UTSW 11 58702498 missense probably damaging 1.00
R1603:Olfr319 UTSW 11 58702460 missense probably benign 0.00
R1935:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1936:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1938:Olfr319 UTSW 11 58702623 makesense probably null
R2436:Olfr319 UTSW 11 58702126 missense probably damaging 0.97
R4243:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4244:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4742:Olfr319 UTSW 11 58701859 missense probably benign
R4801:Olfr319 UTSW 11 58701791 missense probably benign
R4802:Olfr319 UTSW 11 58701791 missense probably benign
R4927:Olfr319 UTSW 11 58701807 missense probably damaging 1.00
R5259:Olfr319 UTSW 11 58701952 missense probably benign 0.07
R5259:Olfr319 UTSW 11 58701953 missense possibly damaging 0.83
R5393:Olfr319 UTSW 11 58702500 missense probably damaging 0.97
R5471:Olfr319 UTSW 11 58702325 missense probably damaging 0.98
R5571:Olfr319 UTSW 11 58702051 missense probably damaging 1.00
R6746:Olfr319 UTSW 11 58702543 missense probably benign
R7045:Olfr319 UTSW 11 58701669 start gained probably benign
X0065:Olfr319 UTSW 11 58702489 missense probably benign 0.02
Z1177:Olfr319 UTSW 11 58702113 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TATAGCCATCTGCCAACCCTTGCAC -3'
(R):5'- CCACTTTGTCCCTTCCAGGAGAATG -3'

Sequencing Primer
(F):5'- AACCCTTGCACTACCCTGTG -3'
(R):5'- CAGGTGGACACAGCTCTACTC -3'
Posted On2013-06-12