Mutagenetix > Incidental Mutation

Incidental Mutation 'R0499:Usp36'

47039

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

MMRRC Submission

038695-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R0499 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118273571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 205 (V205A)

Ref Sequence

ENSEMBL: ENSMUSP00000122761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]

AlphaFold

B1AQJ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000092382
AA Change: V370A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: V370A

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106296
AA Change: V370A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: V370A

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000144153
AA Change: V205A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: V205A

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Meta Mutation Damage Score

0.7521

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	C	3: 36,085,415	V388A	probably damaging	Het
Acpp	T	C	9: 104,320,002	E146G	probably damaging	Het
Adap2	A	T	11: 80,176,079	R276S	probably damaging	Het
Agbl3	A	T	6: 34,839,335	M727L	probably benign	Het
Ahnak	T	A	19: 9,000,264		probably benign	Het
Ankmy1	G	T	1: 92,886,226	D410E	probably damaging	Het
Ankra2	T	C	13: 98,266,454	S70P	probably damaging	Het
Aox4	T	C	1: 58,263,397		probably null	Het
Arl13b	G	A	16: 62,801,733	T399I	probably benign	Het
Atad2	T	G	15: 58,120,949	M328L	probably benign	Het
Atad2	A	T	15: 58,103,240	D652E	possibly damaging	Het
BC052040	C	T	2: 115,642,691	R101W	probably damaging	Het
Ccnb1	T	C	13: 100,780,134		probably null	Het
Ccr2	G	C	9: 124,105,939	K85N	possibly damaging	Het
Ccr2	A	T	9: 124,106,126	T148S	possibly damaging	Het
Cdc20b	T	C	13: 113,055,950	V59A	probably benign	Het
Cdkl3	T	C	11: 52,032,416	S507P	possibly damaging	Het
Celf6	C	A	9: 59,602,878	T86K	probably benign	Het
Ces1g	A	G	8: 93,333,689	F101L	probably benign	Het
Cntnap3	C	T	13: 64,858,678	D107N	probably benign	Het
Col15a1	A	T	4: 47,262,950	D534V	probably damaging	Het
Col27a1	A	G	4: 63,300,741		probably benign	Het
Csmd3	T	C	15: 47,847,131	T1687A	probably benign	Het
Cstf3	A	G	2: 104,649,605	I272M	possibly damaging	Het
Cyp2d40	T	C	15: 82,761,217	T150A	probably benign	Het
Dnah8	T	A	17: 30,715,509	F1489L	possibly damaging	Het
Dopey2	A	T	16: 93,770,437	T1251S	probably benign	Het
Dtx2	G	A	5: 136,029,103	G421R	probably damaging	Het
Dusp27	C	A	1: 166,099,101	V981L	probably benign	Het
Epb41l3	T	A	17: 69,247,659	D251E	probably benign	Het
Erg	A	C	16: 95,360,983	Y305*	probably null	Het
Exosc4	G	A	15: 76,329,566	A197T	probably benign	Het
Fam227b	T	A	2: 126,100,909	I323L	probably benign	Het
Far1	G	T	7: 113,554,296		probably benign	Het
Fmod	A	G	1: 134,041,196	I325V	possibly damaging	Het
Fshr	C	G	17: 89,009,285	S169T	probably benign	Het
Gm17359	T	A	3: 79,405,786	W56R	probably damaging	Het
Gm17660	C	A	5: 104,074,881	G24*	probably null	Het
Gm4076	G	T	13: 85,127,226		noncoding transcript	Het
Gm5134	A	T	10: 75,992,525	Y313F	probably benign	Het
H2-Q6	T	A	17: 35,425,203	F54I	probably damaging	Het
Hcrtr2	C	A	9: 76,254,672	L145F	probably damaging	Het
Hepacam2	A	G	6: 3,476,121	L268P	probably damaging	Het
Herc2	C	A	7: 56,184,369	C3107*	probably null	Het
Herc4	T	C	10: 63,264,032	V78A	probably damaging	Het
Hyal5	T	C	6: 24,877,921	W339R	probably damaging	Het
Igfbp6	T	A	15: 102,147,984		probably null	Het
Il18rap	A	T	1: 40,525,058	H112L	probably benign	Het
Il1r2	T	A	1: 40,123,149	Y317*	probably null	Het
Ints8	C	A	4: 11,246,097	V190L	probably benign	Het
Ipo11	T	C	13: 106,925,087	T22A	probably benign	Het
Itgb4	C	A	11: 115,979,695	R117S	probably benign	Het
Lcorl	C	G	5: 45,734,369	G214A	probably benign	Het
Lgals3bp	T	A	11: 118,398,193		probably null	Het
Lyst	T	A	13: 13,616,713	L54I	probably damaging	Het
Mcm9	T	C	10: 53,538,154	T1015A	probably benign	Het
Mef2d	T	A	3: 88,156,518	I84N	probably damaging	Het
Mmrn2	A	G	14: 34,397,956	N261S	probably damaging	Het
Mpdz	T	C	4: 81,292,531	T1693A	probably benign	Het
Mss51	T	A	14: 20,484,688	Q338L	possibly damaging	Het
Mstn	T	A	1: 53,063,984	Y160N	probably damaging	Het
Muc6	T	C	7: 141,640,468	T1431A	probably benign	Het
Nek9	A	T	12: 85,301,883	M959K	probably benign	Het
Odf3l2	T	C	10: 79,640,265	D155G	probably damaging	Het
Olfr1311	A	T	2: 112,021,432	C141S	probably damaging	Het
Olfr319	G	A	11: 58,702,243	V181I	probably benign	Het
Olfr911-ps1	A	T	9: 38,524,505	M258L	probably benign	Het
Otog	G	T	7: 46,273,832	G1044W	probably damaging	Het
Pcdh9	G	A	14: 93,886,235	T833M	probably damaging	Het
Pdcd10	T	C	3: 75,527,651	K111R	probably damaging	Het
Pde5a	A	G	3: 122,748,458	N199S	probably damaging	Het
Plekhg1	T	C	10: 3,937,971	V355A	probably damaging	Het
Podn	G	T	4: 108,021,594	L359I	probably damaging	Het
Psd	T	C	19: 46,322,161	E483G	probably damaging	Het
Ptch2	T	A	4: 117,111,143	L905*	probably null	Het
Rxfp2	T	A	5: 150,066,415	N420K	probably damaging	Het
Sde2	T	A	1: 180,862,427	D237E	probably benign	Het
Serpina1d	A	T	12: 103,765,757	L281Q	probably damaging	Het
Serpina9	T	C	12: 104,001,470	N222S	probably benign	Het
Sh3bgrl2	A	G	9: 83,577,559	K57E	probably damaging	Het
Shc3	C	T	13: 51,480,228		probably benign	Het
Sik3	T	C	9: 46,208,740	M659T	possibly damaging	Het
Slc23a2	A	G	2: 132,072,017	L280P	probably damaging	Het
Smchd1	G	T	17: 71,387,088	Q1221K	probably benign	Het
Spocd1	A	G	4: 129,955,470	N694S	possibly damaging	Het
Tecta	T	C	9: 42,352,063	D1409G	probably damaging	Het
Tmem131	A	T	1: 36,841,673	V172D	probably damaging	Het
Trpm3	T	C	19: 22,986,873	M1244T	possibly damaging	Het
Ugcg	G	C	4: 59,217,036	V187L	possibly damaging	Het
Usp17le	T	C	7: 104,768,501	N478S	probably benign	Het
Vmn1r25	T	A	6: 57,978,509	Q265L	probably damaging	Het
Vwf	A	T	6: 125,638,114	H1176L	probably benign	Het
Zfyve28	C	T	5: 34,232,206	D217N	possibly damaging	Het
Zranb3	A	C	1: 127,955,080		probably null	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118285023	missense	possibly damaging	0.95
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118263052	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118268585	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118273529	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
R8902:Usp36	UTSW	11	118275014	missense	probably damaging	1.00
R8935:Usp36	UTSW	11	118276831	critical splice acceptor site	probably null
R8995:Usp36	UTSW	11	118284999	missense	probably damaging	1.00
R9024:Usp36	UTSW	11	118276157	missense	possibly damaging	0.95
R9325:Usp36	UTSW	11	118269205	missense	possibly damaging	0.69
R9529:Usp36	UTSW	11	118268635	nonsense	probably null
R9774:Usp36	UTSW	11	118263049	missense	probably damaging	1.00
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACCTGCTGAGCCACTCTGTTGG -3'
(R):5'- ACAAGCATTGCTGAGGGCTGTG -3'

Sequencing Primer
(F):5'- AGTACTGCTGTTTCCCAGAAGAC -3'
(R):5'- CTGAGGGCTGTGGATGC -3'

Posted On

2013-06-12