Incidental Mutation 'R0499:Pcdh9'
ID 47054
Institutional Source Beutler Lab
Gene Symbol Pcdh9
Ensembl Gene ENSMUSG00000055421
Gene Name protocadherin 9
Synonyms C630029H24Rik, A730003J17Rik, C530050I23Rik, LOC382930, 1500001L12Rik
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock # R0499 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 93013410-93890679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 93886235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 833 (T833M)
Ref Sequence ENSEMBL: ENSMUSP00000141396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068992] [ENSMUST00000192221] [ENSMUST00000193901] [ENSMUST00000194056] [ENSMUST00000195376] [ENSMUST00000195826]
AlphaFold F8VPK8
Predicted Effect probably damaging
Transcript: ENSMUST00000068992
AA Change: T833M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070935
Gene: ENSMUSG00000055421
AA Change: T833M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192221
AA Change: T710M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142260
Gene: ENSMUSG00000055421
AA Change: T710M

DomainStartEndE-ValueType
CA 41 127 1.01e-20 SMART
CA 151 233 2.34e-25 SMART
CA 263 344 2.14e-19 SMART
CA 368 447 4.27e-28 SMART
CA 471 550 2.45e-28 SMART
CA 577 659 1.01e-6 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 735 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192817
Predicted Effect probably damaging
Transcript: ENSMUST00000193901
AA Change: T833M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141759
Gene: ENSMUSG00000055421
AA Change: T833M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194056
AA Change: T833M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141602
Gene: ENSMUSG00000055421
AA Change: T833M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194129
Predicted Effect probably damaging
Transcript: ENSMUST00000195376
AA Change: T833M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142224
Gene: ENSMUSG00000055421
AA Change: T833M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195826
AA Change: T833M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141396
Gene: ENSMUSG00000055421
AA Change: T833M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired long-term social and bject recognition and sensorimotor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Pcdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Pcdh9 APN 14 93326694 missense probably damaging 1.00
IGL02183:Pcdh9 APN 14 93886284 missense probably benign 0.01
IGL02244:Pcdh9 APN 14 93326768 missense probably damaging 1.00
IGL02571:Pcdh9 APN 14 93560587 splice site probably benign
IGL03018:Pcdh9 APN 14 93015576 missense probably null
I1329:Pcdh9 UTSW 14 93886209 missense probably benign 0.00
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0477:Pcdh9 UTSW 14 93887678 missense probably damaging 0.99
R0787:Pcdh9 UTSW 14 93886757 missense possibly damaging 0.88
R1205:Pcdh9 UTSW 14 93886065 missense probably benign 0.01
R1616:Pcdh9 UTSW 14 93886969 nonsense probably null
R1620:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1622:Pcdh9 UTSW 14 93885875 missense probably benign 0.03
R1708:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1721:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1753:Pcdh9 UTSW 14 93887225 missense probably benign 0.33
R1799:Pcdh9 UTSW 14 93888671 missense probably benign 0.36
R1867:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1987:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1988:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R2444:Pcdh9 UTSW 14 93886791 missense probably benign 0.10
R3895:Pcdh9 UTSW 14 93887538 missense probably damaging 1.00
R3926:Pcdh9 UTSW 14 93886810 nonsense probably null
R4166:Pcdh9 UTSW 14 93887520 nonsense probably null
R4429:Pcdh9 UTSW 14 93887384 missense probably damaging 0.96
R4589:Pcdh9 UTSW 14 93888192 missense probably damaging 1.00
R4604:Pcdh9 UTSW 14 93887180 missense probably damaging 1.00
R4607:Pcdh9 UTSW 14 93015573 missense probably benign 0.08
R4621:Pcdh9 UTSW 14 93887643 missense probably benign 0.12
R4624:Pcdh9 UTSW 14 93886409 missense probably damaging 1.00
R4712:Pcdh9 UTSW 14 93888631 missense probably damaging 1.00
R4788:Pcdh9 UTSW 14 93887415 missense probably damaging 1.00
R4831:Pcdh9 UTSW 14 93887941 missense probably damaging 1.00
R4883:Pcdh9 UTSW 14 93888728 missense possibly damaging 0.83
R5034:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
R5175:Pcdh9 UTSW 14 93888443 missense probably damaging 1.00
R5637:Pcdh9 UTSW 14 93885762 missense possibly damaging 0.91
R5743:Pcdh9 UTSW 14 93886724 missense probably damaging 1.00
R5753:Pcdh9 UTSW 14 93888161 missense probably damaging 1.00
R5770:Pcdh9 UTSW 14 93886943 missense probably damaging 1.00
R5900:Pcdh9 UTSW 14 93326720 missense probably damaging 0.98
R5986:Pcdh9 UTSW 14 93887048 missense probably damaging 1.00
R6052:Pcdh9 UTSW 14 93885846 missense probably benign 0.40
R6113:Pcdh9 UTSW 14 93887108 missense probably damaging 1.00
R6223:Pcdh9 UTSW 14 93015733 missense probably benign 0.18
R6415:Pcdh9 UTSW 14 93015842 missense possibly damaging 0.83
R6435:Pcdh9 UTSW 14 93887844 missense probably benign 0.01
R7064:Pcdh9 UTSW 14 93886149 missense probably damaging 1.00
R7143:Pcdh9 UTSW 14 93888272 missense probably damaging 0.99
R7219:Pcdh9 UTSW 14 93015780 missense possibly damaging 0.87
R7262:Pcdh9 UTSW 14 93015705 missense probably benign 0.01
R7354:Pcdh9 UTSW 14 93888270 missense probably benign 0.28
R7369:Pcdh9 UTSW 14 93886367 missense possibly damaging 0.67
R7427:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7428:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7780:Pcdh9 UTSW 14 93886551 missense possibly damaging 0.91
R7870:Pcdh9 UTSW 14 93887257 missense probably damaging 0.97
R7921:Pcdh9 UTSW 14 93015565 missense probably benign
R8052:Pcdh9 UTSW 14 93885786 missense probably benign 0.00
R8252:Pcdh9 UTSW 14 93888650 missense probably damaging 1.00
R8671:Pcdh9 UTSW 14 93888650 missense probably damaging 1.00
R8672:Pcdh9 UTSW 14 93887093 missense probably benign 0.08
R8724:Pcdh9 UTSW 14 93887147 missense probably benign 0.19
R8974:Pcdh9 UTSW 14 93887677 missense probably benign 0.20
R9044:Pcdh9 UTSW 14 93886811 missense probably damaging 1.00
X0012:Pcdh9 UTSW 14 93886644 missense possibly damaging 0.71
X0067:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CACTCTGAGGCACTGAAGTGATCTG -3'
(R):5'- GAAGAGAAGCCAGCACCTACTGATG -3'

Sequencing Primer
(F):5'- TCATGAACGGCATCATCGG -3'
(R):5'- CTTGTGGTCAACATAAGTGACCTG -3'
Posted On 2013-06-12