Mutagenetix > Incidental Mutations

Incidental Mutation 'R5165:Tpcn1'

470559

Institutional Source

Beutler Lab

Gene Symbol

Tpcn1

Ensembl Gene

ENSMUSG00000032741

Gene Name

two pore channel 1

Synonyms

5730403B01Rik

MMRRC Submission

042746-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5165 (G1)

Quality Score

150

Status

Validated

Chromosome

Chromosomal Location

120534153-120588673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120557945 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 81 (E81G)

Ref Sequence

ENSEMBL: ENSMUSP00000042188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046426]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046426
AA Change: E81G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: E81G

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	106	332	1.5e-30	PFAM
Pfam:Ion_trans	441	695	1.2e-31	PFAM
SCOP:d1fxkc_	713	795	2e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201971

Meta Mutation Damage Score

0.8667

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actg2	T	A	6: 83,526,832	I77F	probably benign	Het
Actl6a	G	A	3: 32,720,208	V285I	probably benign	Het
Adam9	A	T	8: 24,967,174	I646N	possibly damaging	Het
Ahnak	T	C	19: 9,015,665	I4771T	possibly damaging	Het
Alas1	T	C	9: 106,241,255	T223A	probably damaging	Het
Apc2	A	G	10: 80,315,850	E2246G	probably damaging	Het
Atp1a1	A	G	3: 101,581,789	I795T	probably benign	Het
Cdhr4	T	C	9: 107,997,630	L633P	probably damaging	Het
Cep350	A	G	1: 155,928,368	S990P	probably damaging	Het
Cplx2	A	G	13: 54,378,976	I66V	possibly damaging	Het
Cx3cl1	T	C	8: 94,779,876	S170P	probably benign	Het
Cyth1	T	C	11: 118,169,082	N353S	possibly damaging	Het
Dapp1	T	C	3: 137,939,215		probably null	Het
Dmwd	G	A	7: 19,078,035		probably benign	Het
Dsg1c	A	G	18: 20,277,023	H516R	probably damaging	Het
Efemp2	T	C	19: 5,475,411	C39R	probably damaging	Het
Fnbp4	C	G	2: 90,777,657	Q908E	possibly damaging	Het
Foxred2	A	G	15: 77,956,012	V26A	probably damaging	Het
Gkap1	A	G	13: 58,263,196		probably null	Het
Gstcd	A	C	3: 133,084,679	V109G	probably damaging	Het
Hoxc9	T	A	15: 102,984,000	M215K	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcnj9	A	T	1: 172,323,157	D296E	probably benign	Het
Kctd18	T	C	1: 57,959,236	Y68C	probably damaging	Het
Kif21a	A	T	15: 90,956,376	M1179K	probably benign	Het
Lrfn5	T	C	12: 61,839,624	I66T	possibly damaging	Het
Lrp12	A	G	15: 39,872,461	S692P	probably benign	Het
Lrrc10	A	T	10: 117,046,060	N213I	probably benign	Het
Mettl11b	A	G	1: 163,722,523	I53T	probably benign	Het
Nceh1	G	A	3: 27,241,528	V313I	probably benign	Het
Nkx6-3	T	A	8: 23,153,743	H53Q	probably damaging	Het
Nov	A	G	15: 54,749,189	D198G	probably damaging	Het
Olfr1276	T	A	2: 111,257,223	V36E	possibly damaging	Het
Olfr128	A	G	17: 37,924,361	D265G	probably benign	Het
Olfr1388	A	G	11: 49,444,376	H175R	probably damaging	Het
Olfr1447	A	T	19: 12,901,200	N193K	probably benign	Het
Oxct1	A	T	15: 4,053,769	T157S	possibly damaging	Het
Pcdhga3	A	G	18: 37,675,670	E392G	possibly damaging	Het
Polr1a	T	G	6: 71,967,925	Y1322D	probably damaging	Het
Prkdc	T	A	16: 15,678,272	S776T	probably damaging	Het
Ralgapb	A	G	2: 158,465,912	I1047V	possibly damaging	Het
Sertad4	A	T	1: 192,846,822	S229T	possibly damaging	Het
Shank2	T	A	7: 144,409,636	V327D	possibly damaging	Het
Skint6	A	T	4: 112,865,668	V904E	possibly damaging	Het
Slfn8	A	T	11: 83,017,127	Y197N	probably damaging	Het
Smo	T	A	6: 29,736,078	L23Q	unknown	Het
Snx29	T	A	16: 11,420,775	M23K	probably damaging	Het
Synrg	T	C	11: 83,990,935	S366P	probably benign	Het
Tomm40	A	G	7: 19,713,667		probably null	Het
Trappc1	A	G	11: 69,324,234	Q26R	probably benign	Het
Ttn	T	A	2: 76,776,556		probably null	Het
Usp25	T	A	16: 77,076,405	D450E	possibly damaging	Het
Zmynd19	T	A	2: 24,958,189	Y132*	probably null	Het

Other mutations in Tpcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Tpcn1	APN	5	120545305	missense	probably damaging	0.99
IGL00551:Tpcn1	APN	5	120560325	missense	probably benign	0.31
IGL02197:Tpcn1	APN	5	120553531	missense	probably damaging	1.00
IGL02584:Tpcn1	APN	5	120539032	missense	probably damaging	0.99
IGL03064:Tpcn1	APN	5	120537566	missense	possibly damaging	0.90
PIT1430001:Tpcn1	UTSW	5	120548323	splice site	probably benign
R0295:Tpcn1	UTSW	5	120539060	missense	probably damaging	1.00
R0316:Tpcn1	UTSW	5	120539259	missense	probably damaging	1.00
R1577:Tpcn1	UTSW	5	120544420	missense	probably damaging	1.00
R1660:Tpcn1	UTSW	5	120549515	missense	possibly damaging	0.82
R1819:Tpcn1	UTSW	5	120536227	splice site	probably null
R2051:Tpcn1	UTSW	5	120543388	missense	probably damaging	1.00
R2364:Tpcn1	UTSW	5	120553494	nonsense	probably null
R2497:Tpcn1	UTSW	5	120538998	splice site	probably null
R3965:Tpcn1	UTSW	5	120556575	missense	probably damaging	0.98
R3972:Tpcn1	UTSW	5	120553752	critical splice donor site	probably null
R4062:Tpcn1	UTSW	5	120557897	missense	possibly damaging	0.82
R4343:Tpcn1	UTSW	5	120560220	missense	probably damaging	1.00
R4422:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4423:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4424:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4655:Tpcn1	UTSW	5	120539257	missense	probably damaging	0.98
R4831:Tpcn1	UTSW	5	120553489	missense	probably damaging	1.00
R4910:Tpcn1	UTSW	5	120556519	missense	probably damaging	0.98
R4948:Tpcn1	UTSW	5	120556531	missense	probably benign	0.15
R4965:Tpcn1	UTSW	5	120547487	missense	possibly damaging	0.82
R4976:Tpcn1	UTSW	5	120560322	missense	probably benign
R5071:Tpcn1	UTSW	5	120548269	critical splice donor site	probably null
R5210:Tpcn1	UTSW	5	120539214	missense	probably damaging	1.00
R5910:Tpcn1	UTSW	5	120547397	intron	probably benign
R5939:Tpcn1	UTSW	5	120539827	missense	probably damaging	1.00
R6364:Tpcn1	UTSW	5	120553810	missense	probably damaging	1.00
R6633:Tpcn1	UTSW	5	120544464	missense	probably benign	0.03
R6650:Tpcn1	UTSW	5	120537562	missense	probably null	0.50
R6885:Tpcn1	UTSW	5	120544437	missense	probably benign	0.21
R7038:Tpcn1	UTSW	5	120585277	missense	probably damaging	0.99
R7247:Tpcn1	UTSW	5	120585250	missense	possibly damaging	0.63
R7594:Tpcn1	UTSW	5	120556530	missense	possibly damaging	0.67
R7629:Tpcn1	UTSW	5	120537937	missense	probably benign	0.00
R7854:Tpcn1	UTSW	5	120549588	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGACAGGAGCATCATGGC -3'
(R):5'- GATCAGACAATTCTCCGAGCCC -3'

Sequencing Primer
(F):5'- AGCATCATGGCTCCCTTTTC -3'
(R):5'- AGCCCTCCTGGTTTGGCAG -3'

Posted On

2017-03-13