Incidental Mutation 'R5144:Vmn2r-ps159'
ID470561
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps159
Ensembl Gene ENSMUSG00000057021
Gene Namevomeronasal 2, receptor, pseudogene 159
SynonymsV2r8, Vmn2r-ps160, V2r9
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R5144 (G1)
Quality Score65
Status Validated
Chromosome4
Chromosomal Location156331103-156339499 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 156334397 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074107
SMART Domains Protein: ENSMUSP00000128975
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 423 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096792
SMART Domains Protein: ENSMUSP00000094554
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 441 3.7e-31 PFAM
Pfam:NCD3G 510 563 1.4e-20 PFAM
Pfam:7tm_3 596 831 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189559
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Vmn2r-ps159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Vmn2r-ps159 APN 4 156334196 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338460 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334397 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334562 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338484 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156335590 intron noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334605 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01829:Vmn2r-ps159 APN 4 156333319 intron noncoding transcript
IGL01863:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01864:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01865:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01866:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01868:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01869:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01872:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01873:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01876:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01877:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01878:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01879:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01880:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01884:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01885:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01886:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01887:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01888:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01890:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01891:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01893:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01894:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01896:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01897:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01898:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01899:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01901:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01902:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01903:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01904:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01905:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01906:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01907:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01908:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01909:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01913:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01915:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01916:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01917:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01918:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01919:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01920:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01921:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01922:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01923:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01927:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01928:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01929:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01930:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01931:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01932:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01935:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01937:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01939:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01941:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01942:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01944:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01945:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01946:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01949:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01953:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01954:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01956:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01957:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL02270:Vmn2r-ps159 APN 4 156334655 exon noncoding transcript
R1746:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R1870:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2147:Vmn2r-ps159 UTSW 4 156334719 critical splice donor site noncoding transcript
R2168:Vmn2r-ps159 UTSW 4 156338378 exon noncoding transcript
R2345:Vmn2r-ps159 UTSW 4 156337039 splice site noncoding transcript
R2510:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2899:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3106:Vmn2r-ps159 UTSW 4 156333435 intron noncoding transcript
R3122:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3405:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3430:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3732:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3751:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4108:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4112:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4120:Vmn2r-ps159 UTSW 4 156334483 exon noncoding transcript
R4135:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4302:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4475:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4840:Vmn2r-ps159 UTSW 4 156333438 intron noncoding transcript
R4872:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5271:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5625:Vmn2r-ps159 UTSW 4 156334210 exon noncoding transcript
R5775:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CATGCAGATATACATGACAAGGGC -3'
(R):5'- CAGTGATGTCCATTCCAAGGTG -3'

Sequencing Primer
(F):5'- ATGACATCTTCAGCAAAGGTTG -3'
(R):5'- CCATTCCAAGGTGTTGTTGAATG -3'
Posted On2017-03-14