Incidental Mutation 'R0499:Atad2'
ID 47057
Institutional Source Beutler Lab
Gene Symbol Atad2
Ensembl Gene ENSMUSG00000022360
Gene Name ATPase family, AAA domain containing 2
Synonyms 2610509G12Rik
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock # R0499 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 58094044-58135082 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58120949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 328 (M328L)
Ref Sequence ENSEMBL: ENSMUSP00000043691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]
AlphaFold Q8CDM1
Predicted Effect probably benign
Transcript: ENSMUST00000038194
AA Change: M328L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: M328L

low complexity region 12 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
low complexity region 237 268 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
AAA 438 579 9.93e-21 SMART
low complexity region 622 633 N/A INTRINSIC
SCOP:d1e32a2 751 912 5e-4 SMART
low complexity region 924 947 N/A INTRINSIC
BROMO 955 1067 1.2e-19 SMART
low complexity region 1213 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227134
Predicted Effect probably benign
Transcript: ENSMUST00000228783
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Atad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Atad2 APN 15 58116820 missense probably damaging 1.00
IGL00556:Atad2 APN 15 58100080 missense probably damaging 1.00
IGL00674:Atad2 APN 15 58108386 missense possibly damaging 0.49
IGL01407:Atad2 APN 15 58104525 missense probably benign
IGL02557:Atad2 APN 15 58122597 missense probably benign 0.04
IGL03060:Atad2 APN 15 58122446 unclassified probably benign
IGL03308:Atad2 APN 15 58102523 missense probably benign 0.00
R0113:Atad2 UTSW 15 58120934 unclassified probably benign
R0195:Atad2 UTSW 15 58099954 splice site probably benign
R0310:Atad2 UTSW 15 58114257 missense probably damaging 1.00
R0499:Atad2 UTSW 15 58103240 missense possibly damaging 0.92
R0564:Atad2 UTSW 15 58125833 splice site probably benign
R0578:Atad2 UTSW 15 58105568 missense probably damaging 1.00
R0581:Atad2 UTSW 15 58126664 missense probably benign
R0667:Atad2 UTSW 15 58098719 missense probably benign 0.01
R0697:Atad2 UTSW 15 58105543 missense possibly damaging 0.91
R1219:Atad2 UTSW 15 58134911 missense probably benign 0.00
R1271:Atad2 UTSW 15 58126589 missense probably benign 0.00
R1544:Atad2 UTSW 15 58103364 missense probably damaging 1.00
R1624:Atad2 UTSW 15 58100019 missense probably damaging 1.00
R1853:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1854:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1855:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1860:Atad2 UTSW 15 58096718 splice site probably null
R1861:Atad2 UTSW 15 58096718 splice site probably null
R1876:Atad2 UTSW 15 58106868 missense probably benign 0.00
R1938:Atad2 UTSW 15 58096705 missense possibly damaging 0.76
R2158:Atad2 UTSW 15 58098566 missense possibly damaging 0.95
R3756:Atad2 UTSW 15 58099723 missense probably benign 0.01
R4256:Atad2 UTSW 15 58116856 missense probably damaging 1.00
R4762:Atad2 UTSW 15 58108362 missense probably benign
R4827:Atad2 UTSW 15 58108348 missense probably benign 0.07
R4838:Atad2 UTSW 15 58103283 missense probably damaging 1.00
R5238:Atad2 UTSW 15 58108337 missense possibly damaging 0.90
R5247:Atad2 UTSW 15 58104478 nonsense probably null
R5685:Atad2 UTSW 15 58116798 missense possibly damaging 0.95
R5790:Atad2 UTSW 15 58126594 missense probably damaging 1.00
R5813:Atad2 UTSW 15 58099854 missense probably benign 0.42
R5886:Atad2 UTSW 15 58098514 nonsense probably null
R5955:Atad2 UTSW 15 58105659 missense probably benign 0.06
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6111:Atad2 UTSW 15 58108091 missense probably benign 0.07
R6209:Atad2 UTSW 15 58118415 missense probably damaging 1.00
R6587:Atad2 UTSW 15 58121048 missense probably benign 0.03
R6856:Atad2 UTSW 15 58106813 missense probably damaging 1.00
R7106:Atad2 UTSW 15 58116766 critical splice donor site probably null
R7178:Atad2 UTSW 15 58117293 missense probably damaging 1.00
R7290:Atad2 UTSW 15 58098651 missense probably benign 0.00
R7421:Atad2 UTSW 15 58134926 missense probably benign 0.40
R7583:Atad2 UTSW 15 58126664 missense probably benign
R7861:Atad2 UTSW 15 58125780 missense probably benign 0.10
R7886:Atad2 UTSW 15 58126136 missense probably damaging 1.00
R8072:Atad2 UTSW 15 58099978 missense possibly damaging 0.96
R8126:Atad2 UTSW 15 58105591 missense probably benign 0.02
R8845:Atad2 UTSW 15 58126136 missense probably damaging 1.00
R9027:Atad2 UTSW 15 58132232 missense probably benign 0.04
R9079:Atad2 UTSW 15 58125827 missense probably benign 0.35
R9161:Atad2 UTSW 15 58125789 missense possibly damaging 0.64
R9209:Atad2 UTSW 15 58116798 missense possibly damaging 0.95
R9266:Atad2 UTSW 15 58122571 missense probably benign 0.00
R9306:Atad2 UTSW 15 58096598 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- caactgctgaactctctctcc -3'
Posted On 2013-06-12