Incidental Mutation 'IGL03055:Enpp2'
ID470584
Institutional Source Beutler Lab
Gene Symbol Enpp2
Ensembl Gene ENSMUSG00000022425
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 2
SynonymsPdnp2, Npps2, PD-Ialpha, ATX, Autotaxin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03055 (G1)
Quality Score29
Status Validated
Chromosome15
Chromosomal Location54838901-54952892 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 54866085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516]
Predicted Effect probably null
Transcript: ENSMUST00000041591
SMART Domains Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 4.7e-41 PFAM
Pfam:Phosphodiest 278 477 3.3e-40 PFAM
Endonuclease_NS 613 844 3.93e-36 SMART
NUC 614 844 1.32e-109 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167541
SMART Domains Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 284 5.4e-41 PFAM
Pfam:Phosphodiest 278 477 3.4e-40 PFAM
Endonuclease_NS 638 869 3.93e-36 SMART
NUC 639 869 1.32e-109 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171545
SMART Domains Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 283 2.8e-43 PFAM
Pfam:Phosphodiest 275 529 2.8e-36 PFAM
Endonuclease_NS 665 896 3.93e-36 SMART
NUC 666 896 1.32e-109 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173516
SMART Domains Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 2.8e-41 PFAM
Pfam:Phosphodiest 276 529 7.8e-36 PFAM
Endonuclease_NS 661 892 3.93e-36 SMART
NUC 662 892 1.32e-109 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228823
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cchcr1 T A 17: 35,526,619 M406K probably benign Het
Cdhr1 A T 14: 37,095,097 D102E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Gfral T A 9: 76,208,549 T48S probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nefm T C 14: 68,122,909 T371A probably damaging Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Olfr656 A T 7: 104,618,206 I176F probably damaging Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Stk11 A C 10: 80,128,086 D96A probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Enpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Enpp2 APN 15 54875650 critical splice donor site probably null
IGL01290:Enpp2 APN 15 54919602 missense possibly damaging 0.79
IGL01296:Enpp2 APN 15 54875669 missense probably damaging 1.00
IGL01650:Enpp2 APN 15 54919933 missense probably benign
IGL02470:Enpp2 APN 15 54839460 missense probably damaging 1.00
IGL02522:Enpp2 APN 15 54898940 missense probably damaging 0.99
IGL02727:Enpp2 APN 15 54910181 missense probably damaging 1.00
IGL03178:Enpp2 APN 15 54866006 missense probably benign
PIT4260001:Enpp2 UTSW 15 54844378 critical splice donor site probably null
R0302:Enpp2 UTSW 15 54860061 missense probably benign 0.15
R0304:Enpp2 UTSW 15 54877806 missense probably benign 0.07
R0385:Enpp2 UTSW 15 54882159 missense probably damaging 1.00
R0440:Enpp2 UTSW 15 54847237 splice site probably benign
R0696:Enpp2 UTSW 15 54897696 nonsense probably null
R0879:Enpp2 UTSW 15 54877930 missense probably damaging 0.98
R0924:Enpp2 UTSW 15 54906959 splice site probably benign
R0989:Enpp2 UTSW 15 54875759 missense possibly damaging 0.88
R1126:Enpp2 UTSW 15 54906826 critical splice donor site probably null
R1434:Enpp2 UTSW 15 54862681 missense probably damaging 1.00
R1447:Enpp2 UTSW 15 54919598 critical splice donor site probably null
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1501:Enpp2 UTSW 15 54839514 missense probably damaging 1.00
R1546:Enpp2 UTSW 15 54845829 missense probably benign 0.01
R1673:Enpp2 UTSW 15 54910196 splice site probably null
R1853:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1854:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1855:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1969:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R1970:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R2060:Enpp2 UTSW 15 54875714 missense probably damaging 1.00
R2122:Enpp2 UTSW 15 54897792 nonsense probably null
R2275:Enpp2 UTSW 15 54897794 missense probably damaging 1.00
R2517:Enpp2 UTSW 15 54919694 missense probably damaging 0.99
R3881:Enpp2 UTSW 15 54919692 missense probably damaging 1.00
R3934:Enpp2 UTSW 15 54845921 missense probably benign 0.03
R4722:Enpp2 UTSW 15 54887589 missense probably damaging 0.99
R4765:Enpp2 UTSW 15 54875672 missense possibly damaging 0.91
R4799:Enpp2 UTSW 15 54910094 missense probably damaging 1.00
R4934:Enpp2 UTSW 15 54882147 missense probably damaging 1.00
R4976:Enpp2 UTSW 15 54870305 nonsense probably null
R5068:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5069:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5070:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5119:Enpp2 UTSW 15 54870305 nonsense probably null
R5134:Enpp2 UTSW 15 54899330 missense probably damaging 1.00
R5162:Enpp2 UTSW 15 54847296 missense probably benign 0.06
R5218:Enpp2 UTSW 15 54887586 missense possibly damaging 0.86
R5415:Enpp2 UTSW 15 54882156 missense probably damaging 1.00
R5965:Enpp2 UTSW 15 54882971 critical splice donor site probably null
R6086:Enpp2 UTSW 15 54845834 missense probably damaging 1.00
R6229:Enpp2 UTSW 15 54877832 missense probably damaging 1.00
R6306:Enpp2 UTSW 15 54899346 missense probably damaging 1.00
R6314:Enpp2 UTSW 15 54865970 missense probably damaging 0.99
R6403:Enpp2 UTSW 15 54863764 missense probably damaging 1.00
R6515:Enpp2 UTSW 15 54860093 missense possibly damaging 0.75
R6525:Enpp2 UTSW 15 54870211 missense probably benign 0.01
R6536:Enpp2 UTSW 15 54862631 missense probably damaging 1.00
R7070:Enpp2 UTSW 15 54899289 missense probably damaging 1.00
R7077:Enpp2 UTSW 15 54901391 missense probably benign 0.36
R7265:Enpp2 UTSW 15 54910033 critical splice donor site probably null
R7324:Enpp2 UTSW 15 54877774 critical splice donor site probably null
R7331:Enpp2 UTSW 15 54875670 missense probably damaging 1.00
R7452:Enpp2 UTSW 15 54866736 missense probably damaging 0.99
R7494:Enpp2 UTSW 15 54910158 missense probably damaging 1.00
R7557:Enpp2 UTSW 15 54910140 missense probably damaging 1.00
R7574:Enpp2 UTSW 15 54851417 missense probably benign
R7665:Enpp2 UTSW 15 54839394 missense probably damaging 0.98
R7744:Enpp2 UTSW 15 54901233 splice site probably null
R7940:Enpp2 UTSW 15 54906928 missense probably damaging 1.00
R7942:Enpp2 UTSW 15 54845879 missense probably damaging 1.00
R7951:Enpp2 UTSW 15 54919693 missense probably benign 0.00
R8069:Enpp2 UTSW 15 54847301 missense probably damaging 0.96
R8301:Enpp2 UTSW 15 54851407 missense probably benign
R8376:Enpp2 UTSW 15 54910095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACATGCCATCTGCGTTCC -3'
(R):5'- GACCTTGAGTTTTAAACTGCCTTC -3'

Sequencing Primer
(F):5'- ATCTGCGTTCCACCAATAAATG -3'
(R):5'- ATCCTTTTGTTGGGCTAGC -3'
Posted On2017-03-15