Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Rb1cc1'

470585

Institutional Source

Beutler Lab

Gene Symbol

Rb1cc1

Ensembl Gene

ENSMUSG00000025907

Gene Name

RB1-inducible coiled-coil 1

Synonyms

Cc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200

MMRRC Submission

042772-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6206197-6276648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6234230 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 67 (D67G)

Ref Sequence

ENSEMBL: ENSMUSP00000125396 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000159906] [ENSMUST00000160062] [ENSMUST00000160871] [ENSMUST00000162795]

AlphaFold

Q9ESK9

Predicted Effect

probably damaging
Transcript: ENSMUST00000027040
AA Change: D67G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: D67G

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	7e-4	SMART
Blast:UBQ	3	76	8e-12	BLAST
low complexity region	471	486	N/A	INTRINSIC
low complexity region	643	653	N/A	INTRINSIC
low complexity region	658	674	N/A	INTRINSIC
coiled coil region	859	921	N/A	INTRINSIC
low complexity region	1033	1045	N/A	INTRINSIC
low complexity region	1055	1066	N/A	INTRINSIC
SCOP:d1eq1a_	1159	1305	1e-3	SMART
low complexity region	1374	1388	N/A	INTRINSIC
Pfam:ATG11	1447	1583	5.6e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159906
AA Change: D67G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125396
Gene: ENSMUSG00000025907
AA Change: D67G

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	5e-6	SMART
Blast:UBQ	3	76	3e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160062

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160871
AA Change: D67G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123768
Gene: ENSMUSG00000025907
AA Change: D67G

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	1e-5	SMART
Blast:UBQ	3	76	3e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000161327

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162210

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162795
AA Change: D67G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907
AA Change: D67G

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	2e-4	SMART
Blast:UBQ	3	76	4e-12	BLAST
low complexity region	454	469	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	641	657	N/A	INTRINSIC
coiled coil region	842	865	N/A	INTRINSIC

Meta Mutation Damage Score

0.2047

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,438	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,646,263		probably benign	Het
6330409D20Rik	T	A	2: 32,740,540		probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Amigo2	A	G	15: 97,246,061	F160S	probably damaging	Het
Arcn1	A	T	9: 44,760,027	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,185,109	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830	S163T	probably damaging	Het
BC003331	T	A	1: 150,382,389	D165V	probably damaging	Het
Birc6	T	C	17: 74,606,141		probably benign	Het
Ccm2	G	A	11: 6,561,181		probably benign	Het
Cdc42bpa	T	C	1: 180,072,413	V431A	probably benign	Het
Cdh7	T	A	1: 110,138,000	M668K	probably damaging	Het
Cfap43	A	T	19: 47,825,925	W157R	probably damaging	Het
Chrm5	T	C	2: 112,480,384	Y129C	probably damaging	Het
Chrna5	A	G	9: 55,006,519	I421V	possibly damaging	Het
Clk1	T	A	1: 58,414,613	T301S	probably benign	Het
Col6a3	G	T	1: 90,816,538		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam198a	T	G	9: 121,965,661	S294A	probably benign	Het
Fbxw19	T	C	9: 109,484,428	Y234C	probably benign	Het
Fgd4	T	A	16: 16,484,142	N183I	probably benign	Het
Fnip2	T	C	3: 79,572,538		probably benign	Het
Gm9847	T	A	12: 14,495,015		noncoding transcript	Het
H2-T23	A	G	17: 36,032,607		probably null	Het
Hdlbp	T	C	1: 93,420,193	E613G	probably damaging	Het
Kat6a	G	A	8: 22,911,713	R366H	probably damaging	Het
Kctd4	A	G	14: 75,962,687	T33A	probably benign	Het
Klrb1c	T	A	6: 128,780,299	S268C	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,114,608	E245G	probably damaging	Het
Mast3	A	T	8: 70,788,245	I220N	probably damaging	Het
Mfap3	A	G	11: 57,529,813	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,004	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,536,351	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,934,983	D158G	probably damaging	Het
Olfr1176	A	G	2: 88,339,748	Y61C	possibly damaging	Het
Olfr812	T	A	10: 129,842,781	D87V	possibly damaging	Het
Pask	A	G	1: 93,310,083		probably benign	Het
Pif1	G	T	9: 65,588,092	A95S	probably benign	Het
Plppr2	T	C	9: 21,941,132	F104S	probably damaging	Het
Prmt9	G	A	8: 77,564,997	V333M	probably benign	Het
Pten	A	T	19: 32,815,497	M239L	probably benign	Het
Reg2	T	A	6: 78,405,547	L12*	probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,281,722		probably null	Het
Tcaf3	G	T	6: 42,593,715	R368S	probably benign	Het
Tfcp2	A	G	15: 100,520,714	V189A	probably damaging	Het
Uhrf1bp1	A	G	17: 27,856,763	I5V	probably benign	Het
Wdr12	T	C	1: 60,087,084	S191G	probably damaging	Het
Zfp536	G	A	7: 37,480,760	R807W	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Rb1cc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Rb1cc1	APN	1	6249506	missense	probably damaging	0.97
IGL00590:Rb1cc1	APN	1	6238296	missense	probably damaging	1.00
IGL00678:Rb1cc1	APN	1	6234085	missense	probably damaging	1.00
IGL00705:Rb1cc1	APN	1	6244133	missense	probably benign	0.00
IGL00957:Rb1cc1	APN	1	6249539	missense	probably damaging	1.00
IGL01363:Rb1cc1	APN	1	6250109	missense	probably benign	0.06
IGL01599:Rb1cc1	APN	1	6248771	nonsense	probably null
IGL01610:Rb1cc1	APN	1	6248481	missense	probably benign	0.03
IGL01929:Rb1cc1	APN	1	6240159	missense	possibly damaging	0.82
IGL01978:Rb1cc1	APN	1	6238368	missense	probably damaging	1.00
IGL02312:Rb1cc1	APN	1	6265623	critical splice donor site	probably null
IGL02471:Rb1cc1	APN	1	6240051	missense	probably benign	0.01
IGL02677:Rb1cc1	APN	1	6249419	missense	probably benign
IGL02702:Rb1cc1	APN	1	6240023	missense	probably damaging	0.99
IGL02816:Rb1cc1	APN	1	6262828	splice site	probably benign
IGL02899:Rb1cc1	APN	1	6264583	missense	probably damaging	1.00
fingerling	UTSW	1	6261032	missense	probably damaging	1.00
tots	UTSW	1	6245637	missense	probably damaging	0.99
IGL02988:Rb1cc1	UTSW	1	6247811	critical splice donor site	probably null
R0020:Rb1cc1	UTSW	1	6264548	missense	possibly damaging	0.86
R0254:Rb1cc1	UTSW	1	6262847	missense	probably damaging	1.00
R0390:Rb1cc1	UTSW	1	6248634	missense	probably damaging	1.00
R0466:Rb1cc1	UTSW	1	6263267	splice site	probably null
R0482:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R0510:Rb1cc1	UTSW	1	6249171	missense	probably benign	0.00
R0512:Rb1cc1	UTSW	1	6248543	missense	probably damaging	1.00
R0616:Rb1cc1	UTSW	1	6244262	missense	possibly damaging	0.80
R0617:Rb1cc1	UTSW	1	6248790	missense	possibly damaging	0.83
R0837:Rb1cc1	UTSW	1	6234271	splice site	probably null
R1399:Rb1cc1	UTSW	1	6249818	missense	probably benign	0.00
R1532:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R1542:Rb1cc1	UTSW	1	6244249	missense	possibly damaging	0.82
R1746:Rb1cc1	UTSW	1	6263013	splice site	probably null
R1764:Rb1cc1	UTSW	1	6214680	intron	probably benign
R1968:Rb1cc1	UTSW	1	6248195	splice site	probably null
R2025:Rb1cc1	UTSW	1	6245309	missense	probably damaging	1.00
R2076:Rb1cc1	UTSW	1	6250038	missense	possibly damaging	0.82
R2101:Rb1cc1	UTSW	1	6249335	missense	probably benign
R2249:Rb1cc1	UTSW	1	6272724	missense	probably damaging	1.00
R3176:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3276:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3716:Rb1cc1	UTSW	1	6270690	critical splice acceptor site	probably null
R3747:Rb1cc1	UTSW	1	6248742	missense	possibly damaging	0.92
R3850:Rb1cc1	UTSW	1	6250113	missense	probably benign	0.22
R3967:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3969:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3972:Rb1cc1	UTSW	1	6249000	missense	probably benign	0.00
R4166:Rb1cc1	UTSW	1	6265663	intron	probably benign
R4168:Rb1cc1	UTSW	1	6230024	missense	probably damaging	1.00
R4358:Rb1cc1	UTSW	1	6245637	missense	probably damaging	0.99
R4370:Rb1cc1	UTSW	1	6248547	missense	probably damaging	1.00
R4869:Rb1cc1	UTSW	1	6215021	intron	probably benign
R4945:Rb1cc1	UTSW	1	6249627	missense	probably benign	0.24
R5111:Rb1cc1	UTSW	1	6214634	intron	probably benign
R5175:Rb1cc1	UTSW	1	6248321	missense	probably benign
R5271:Rb1cc1	UTSW	1	6249193	nonsense	probably null
R5341:Rb1cc1	UTSW	1	6215042	intron	probably benign
R5952:Rb1cc1	UTSW	1	6248182	missense	probably benign
R5992:Rb1cc1	UTSW	1	6233996	missense	probably damaging	1.00
R6054:Rb1cc1	UTSW	1	6249834	missense	probably benign	0.01
R6064:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R6313:Rb1cc1	UTSW	1	6244133	missense	probably benign	0.00
R6345:Rb1cc1	UTSW	1	6263257	missense	probably benign	0.00
R6488:Rb1cc1	UTSW	1	6270727	missense	probably damaging	0.97
R6566:Rb1cc1	UTSW	1	6249092	missense	probably benign	0.15
R6739:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R6829:Rb1cc1	UTSW	1	6249264	missense	probably benign	0.04
R6945:Rb1cc1	UTSW	1	6261032	missense	probably damaging	1.00
R6976:Rb1cc1	UTSW	1	6262902	missense	probably benign	0.01
R7031:Rb1cc1	UTSW	1	6238466	critical splice donor site	probably null
R7066:Rb1cc1	UTSW	1	6250005	missense	possibly damaging	0.69
R7185:Rb1cc1	UTSW	1	6238383	missense	probably damaging	1.00
R7276:Rb1cc1	UTSW	1	6249192	missense	probably benign	0.13
R7448:Rb1cc1	UTSW	1	6245503	missense	probably damaging	1.00
R7463:Rb1cc1	UTSW	1	6249180	missense	probably benign
R7484:Rb1cc1	UTSW	1	6274217	missense	probably damaging	1.00
R7496:Rb1cc1	UTSW	1	6248191	missense	probably null	0.02
R7618:Rb1cc1	UTSW	1	6265558	splice site	probably null
R7681:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R7774:Rb1cc1	UTSW	1	6248085	missense	possibly damaging	0.63
R7780:Rb1cc1	UTSW	1	6248914	nonsense	probably null
R7947:Rb1cc1	UTSW	1	6248562	missense	probably damaging	1.00
R8057:Rb1cc1	UTSW	1	6245219	missense	probably damaging	1.00
R8094:Rb1cc1	UTSW	1	6263224	nonsense	probably null
R8527:Rb1cc1	UTSW	1	6244875	missense	probably damaging	1.00
R8758:Rb1cc1	UTSW	1	6240227	missense	probably benign	0.10
R8843:Rb1cc1	UTSW	1	6245171	missense	probably damaging	1.00
R8922:Rb1cc1	UTSW	1	6248970	missense	probably benign
R8937:Rb1cc1	UTSW	1	6263217	missense	probably benign
R9018:Rb1cc1	UTSW	1	6249266	missense	probably benign
R9106:Rb1cc1	UTSW	1	6248885	missense
R9127:Rb1cc1	UTSW	1	6262849	missense	probably damaging	1.00
R9130:Rb1cc1	UTSW	1	6244885	missense	probably damaging	0.99
R9311:Rb1cc1	UTSW	1	6240315	missense	probably damaging	1.00
R9365:Rb1cc1	UTSW	1	6244893	missense	probably damaging	1.00
R9563:Rb1cc1	UTSW	1	6244115	missense	probably benign
R9598:Rb1cc1	UTSW	1	6239965	missense	probably damaging	1.00
R9608:Rb1cc1	UTSW	1	6248304	missense	probably benign	0.02
R9659:Rb1cc1	UTSW	1	6248449	missense	probably benign	0.33
R9799:Rb1cc1	UTSW	1	6244902	missense	probably damaging	1.00
Z1088:Rb1cc1	UTSW	1	6249018	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTGTGTACTTACAGCGCTGG -3'
(R):5'- GACTTCTCTGCTATCTAGATTGGAATG -3'

Sequencing Primer
(F):5'- GGACGGTAGGTGTCAAAGATCCTC -3'
(R):5'- GTTTATATCATACCACTGCAAGCTG -3'

Posted On

2017-03-16