Incidental Mutation 'R5196:Tfcp2'
ID470586
Institutional Source Beutler Lab
Gene Symbol Tfcp2
Ensembl Gene ENSMUSG00000009733
Gene Nametranscription factor CP2
SynonymsTcfcp2, CP-2, D230015P20Rik, LBP1, UBP-1, CP2, LSF, LBP-1c, LBP-1d
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100498012-100552008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100520714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 189 (V189A)
Ref Sequence ENSEMBL: ENSMUSP00000155683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009877] [ENSMUST00000229265] [ENSMUST00000229581] [ENSMUST00000229696]
Predicted Effect probably damaging
Transcript: ENSMUST00000009877
AA Change: V189A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009877
Gene: ENSMUSG00000009733
AA Change: V189A

DomainStartEndE-ValueType
Pfam:CP2 44 260 8.6e-60 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229265
Predicted Effect possibly damaging
Transcript: ENSMUST00000229581
AA Change: V189A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000229696
AA Change: V189A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230363
Meta Mutation Damage Score 0.4504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that binds the alpha-globin promoter and activates transcription of the alpha-globin gene. The encoded protein regulates erythroid gene expression, plays a role in the transcriptional switch of globin gene promoters, and it activates many other cellular and viral gene promoters. The gene product interacts with certain inflammatory response factors, and polymorphisms of this gene may be involved in the pathogenesis of Alzheimer's disease. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no apparent alterations in overall behavior, hematopoiesis, globin chain synthesis, or immunological function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Tfcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Tfcp2 APN 15 100513178 unclassified probably benign
IGL00916:Tfcp2 APN 15 100520678 missense probably damaging 1.00
IGL01819:Tfcp2 APN 15 100504439 missense probably benign 0.02
IGL02075:Tfcp2 APN 15 100513180 unclassified probably benign
IGL02370:Tfcp2 APN 15 100512304 missense probably damaging 1.00
IGL02608:Tfcp2 APN 15 100514110 missense possibly damaging 0.48
IGL03001:Tfcp2 APN 15 100528421 missense possibly damaging 0.47
R0153:Tfcp2 UTSW 15 100514827 missense probably damaging 1.00
R2879:Tfcp2 UTSW 15 100551320 unclassified probably null
R3103:Tfcp2 UTSW 15 100525600 missense probably damaging 1.00
R4302:Tfcp2 UTSW 15 100514849 missense possibly damaging 0.77
R4929:Tfcp2 UTSW 15 100528489 missense probably benign 0.29
R4965:Tfcp2 UTSW 15 100525650 missense probably damaging 1.00
R5407:Tfcp2 UTSW 15 100527874 splice site probably null
R6091:Tfcp2 UTSW 15 100512313 missense probably damaging 1.00
R6136:Tfcp2 UTSW 15 100512313 missense probably damaging 1.00
R7241:Tfcp2 UTSW 15 100518587 missense possibly damaging 0.95
R7808:Tfcp2 UTSW 15 100522429 missense probably damaging 1.00
X0011:Tfcp2 UTSW 15 100513080 critical splice donor site probably null
X0040:Tfcp2 UTSW 15 100518598 missense probably damaging 1.00
X0063:Tfcp2 UTSW 15 100512301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGTTTTAAGGCGGGCAC -3'
(R):5'- AGAGGACTGCATTCCTGTGG -3'

Sequencing Primer
(F):5'- CACACGGCCTGGGACAC -3'
(R):5'- TGGTTCTTCACAGCGGC -3'
Posted On2017-03-16