Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Tfcp2'

470586

Institutional Source

Beutler Lab

Gene Symbol

Tfcp2

Ensembl Gene

ENSMUSG00000009733

Gene Name

transcription factor CP2

Synonyms

Tcfcp2, CP-2, D230015P20Rik, LBP1, UBP-1, CP2, LSF, LBP-1c, LBP-1d

MMRRC Submission

042772-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100498012-100552008 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100520714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 189 (V189A)

Ref Sequence

ENSEMBL: ENSMUSP00000155683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009877] [ENSMUST00000229265] [ENSMUST00000229581] [ENSMUST00000229696]

AlphaFold

Q9ERA0

Predicted Effect

probably damaging
Transcript: ENSMUST00000009877
AA Change: V189A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000009877
Gene: ENSMUSG00000009733
AA Change: V189A

Domain	Start	End	E-Value	Type
Pfam:CP2	44	260	8.6e-60	PFAM
low complexity region	287	302	N/A	INTRINSIC
low complexity region	404	415	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229265

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229581
AA Change: V189A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000229696
AA Change: V189A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230363

Meta Mutation Damage Score

0.4504

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that binds the alpha-globin promoter and activates transcription of the alpha-globin gene. The encoded protein regulates erythroid gene expression, plays a role in the transcriptional switch of globin gene promoters, and it activates many other cellular and viral gene promoters. The gene product interacts with certain inflammatory response factors, and polymorphisms of this gene may be involved in the pathogenesis of Alzheimer's disease. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no apparent alterations in overall behavior, hematopoiesis, globin chain synthesis, or immunological function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,438	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,646,263		probably benign	Het
6330409D20Rik	T	A	2: 32,740,540		probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Amigo2	A	G	15: 97,246,061	F160S	probably damaging	Het
Arcn1	A	T	9: 44,760,027	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,185,109	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830	S163T	probably damaging	Het
BC003331	T	A	1: 150,382,389	D165V	probably damaging	Het
Birc6	T	C	17: 74,606,141		probably benign	Het
Ccm2	G	A	11: 6,561,181		probably benign	Het
Cdc42bpa	T	C	1: 180,072,413	V431A	probably benign	Het
Cdh7	T	A	1: 110,138,000	M668K	probably damaging	Het
Cfap43	A	T	19: 47,825,925	W157R	probably damaging	Het
Chrm5	T	C	2: 112,480,384	Y129C	probably damaging	Het
Chrna5	A	G	9: 55,006,519	I421V	possibly damaging	Het
Clk1	T	A	1: 58,414,613	T301S	probably benign	Het
Col6a3	G	T	1: 90,816,538		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam198a	T	G	9: 121,965,661	S294A	probably benign	Het
Fbxw19	T	C	9: 109,484,428	Y234C	probably benign	Het
Fgd4	T	A	16: 16,484,142	N183I	probably benign	Het
Fnip2	T	C	3: 79,572,538		probably benign	Het
Gm9847	T	A	12: 14,495,015		noncoding transcript	Het
H2-T23	A	G	17: 36,032,607		probably null	Het
Hdlbp	T	C	1: 93,420,193	E613G	probably damaging	Het
Kat6a	G	A	8: 22,911,713	R366H	probably damaging	Het
Kctd4	A	G	14: 75,962,687	T33A	probably benign	Het
Klrb1c	T	A	6: 128,780,299	S268C	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,114,608	E245G	probably damaging	Het
Mast3	A	T	8: 70,788,245	I220N	probably damaging	Het
Mfap3	A	G	11: 57,529,813	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,004	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,536,351	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,934,983	D158G	probably damaging	Het
Olfr1176	A	G	2: 88,339,748	Y61C	possibly damaging	Het
Olfr812	T	A	10: 129,842,781	D87V	possibly damaging	Het
Pask	A	G	1: 93,310,083		probably benign	Het
Pif1	G	T	9: 65,588,092	A95S	probably benign	Het
Plppr2	T	C	9: 21,941,132	F104S	probably damaging	Het
Prmt9	G	A	8: 77,564,997	V333M	probably benign	Het
Pten	A	T	19: 32,815,497	M239L	probably benign	Het
Rb1cc1	A	G	1: 6,234,230	D67G	probably damaging	Het
Reg2	T	A	6: 78,405,547	L12*	probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,281,722		probably null	Het
Tcaf3	G	T	6: 42,593,715	R368S	probably benign	Het
Uhrf1bp1	A	G	17: 27,856,763	I5V	probably benign	Het
Wdr12	T	C	1: 60,087,084	S191G	probably damaging	Het
Zfp536	G	A	7: 37,480,760	R807W	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Tfcp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Tfcp2	APN	15	100513178	unclassified	probably benign
IGL00916:Tfcp2	APN	15	100520678	missense	probably damaging	1.00
IGL01819:Tfcp2	APN	15	100504439	missense	probably benign	0.02
IGL02075:Tfcp2	APN	15	100513180	unclassified	probably benign
IGL02370:Tfcp2	APN	15	100512304	missense	probably damaging	1.00
IGL02608:Tfcp2	APN	15	100514110	missense	possibly damaging	0.48
IGL03001:Tfcp2	APN	15	100528421	missense	possibly damaging	0.47
R0153:Tfcp2	UTSW	15	100514827	missense	probably damaging	1.00
R2879:Tfcp2	UTSW	15	100551320	splice site	probably null
R3103:Tfcp2	UTSW	15	100525600	missense	probably damaging	1.00
R4302:Tfcp2	UTSW	15	100514849	missense	possibly damaging	0.77
R4929:Tfcp2	UTSW	15	100528489	missense	probably benign	0.29
R4965:Tfcp2	UTSW	15	100525650	missense	probably damaging	1.00
R5407:Tfcp2	UTSW	15	100527874	splice site	probably null
R6091:Tfcp2	UTSW	15	100512313	missense	probably damaging	1.00
R6136:Tfcp2	UTSW	15	100512313	missense	probably damaging	1.00
R7241:Tfcp2	UTSW	15	100518587	missense	possibly damaging	0.95
R7808:Tfcp2	UTSW	15	100522429	missense	probably damaging	1.00
R8204:Tfcp2	UTSW	15	100522448	missense	possibly damaging	0.68
R8841:Tfcp2	UTSW	15	100513108	missense	probably damaging	1.00
R8931:Tfcp2	UTSW	15	100504417	missense	possibly damaging	0.58
R9053:Tfcp2	UTSW	15	100498211	missense
R9080:Tfcp2	UTSW	15	100498087	frame shift	probably null
R9293:Tfcp2	UTSW	15	100514053	missense	probably benign
X0011:Tfcp2	UTSW	15	100513080	critical splice donor site	probably null
X0040:Tfcp2	UTSW	15	100518598	missense	probably damaging	1.00
X0063:Tfcp2	UTSW	15	100512301	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACGGTTTTAAGGCGGGCAC -3'
(R):5'- AGAGGACTGCATTCCTGTGG -3'

Sequencing Primer
(F):5'- CACACGGCCTGGGACAC -3'
(R):5'- TGGTTCTTCACAGCGGC -3'

Posted On

2017-03-16