Incidental Mutation 'R5197:Psmd13'
ID470588
Institutional Source Beutler Lab
Gene Symbol Psmd13
Ensembl Gene ENSMUSG00000025487
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms26S proteasome subunit p40.5, S11
MMRRC Submission 042773-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5197 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140881968-140898643 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 140894461 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026560] [ENSMUST00000026561] [ENSMUST00000163610] [ENSMUST00000164681] [ENSMUST00000166889]
Predicted Effect probably benign
Transcript: ENSMUST00000026560
SMART Domains Protein: ENSMUSP00000026560
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PINT 263 356 2.26e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026561
SMART Domains Protein: ENSMUSP00000026561
Gene: ENSMUSG00000025488

DomainStartEndE-ValueType
Pfam:COX8 25 67 9.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129683
Predicted Effect probably benign
Transcript: ENSMUST00000130462
SMART Domains Protein: ENSMUSP00000126160
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
PINT 100 189 6.59e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151644
Predicted Effect probably benign
Transcript: ENSMUST00000163610
SMART Domains Protein: ENSMUSP00000130580
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PDB:4CR4|O 16 347 7e-44 PDB
Blast:PINT 245 329 9e-26 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000164681
SMART Domains Protein: ENSMUSP00000132405
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PDB:4CR4|O 16 184 1e-12 PDB
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165539
SMART Domains Protein: ENSMUSP00000130256
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
Pfam:PCI 1 63 7.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166889
SMART Domains Protein: ENSMUSP00000126532
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,622,582 E247G possibly damaging Het
Adgra3 A G 5: 49,960,754 F1151L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh4a1 A C 4: 139,648,301 probably benign Het
Anln A T 9: 22,352,781 probably null Het
Aste1 T C 9: 105,405,054 S74P probably damaging Het
Atp6v0e2 G A 6: 48,540,117 R77H probably benign Het
Brpf1 A G 6: 113,319,941 D962G possibly damaging Het
Btbd2 T C 10: 80,646,419 D249G probably damaging Het
Catsper3 T C 13: 55,808,176 probably null Het
Cfap43 A G 19: 47,897,372 L268P probably damaging Het
Cftr T C 6: 18,255,414 V540A probably benign Het
Col22a1 C T 15: 72,009,406 G32D probably damaging Het
Col5a2 G T 1: 45,393,081 P804Q probably benign Het
Cyp2d41-ps A G 15: 82,778,780 noncoding transcript Het
Cyp39a1 T G 17: 43,746,538 L423V possibly damaging Het
Elmo1 T G 13: 20,564,437 V484G probably benign Het
Eps8 C A 6: 137,490,290 Q656H probably damaging Het
Eps8 T C 6: 137,490,291 Q656R possibly damaging Het
Fam71f2 G T 6: 29,281,222 probably benign Het
Fshb T C 2: 107,057,509 D55G possibly damaging Het
Gm13089 A C 4: 143,698,062 C270W possibly damaging Het
Herc1 C A 9: 66,448,504 Q2346K probably damaging Het
Hist1h3d T A 13: 23,576,130 L110Q probably damaging Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Ift74 T A 4: 94,662,596 D328E probably benign Het
Kif21b A T 1: 136,144,625 K23M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lipc T A 9: 70,798,391 E470V probably benign Het
Lrrc4 G T 6: 28,830,143 T68K probably damaging Het
Lrrc63 T A 14: 75,084,882 H594L possibly damaging Het
Mfsd14a A T 3: 116,648,501 probably benign Het
Mob2 T C 7: 142,009,537 probably null Het
Nckap5 T A 1: 126,222,673 H105L possibly damaging Het
Ngef C A 1: 87,509,368 G133* probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1000 T C 2: 85,608,447 I154M probably benign Het
Olfr113 T G 17: 37,575,220 I68L probably benign Het
Olfr1477 G T 19: 13,502,384 V14F possibly damaging Het
Olfr31 T A 14: 14,328,462 M117K probably damaging Het
Olfr593 G A 7: 103,212,000 V47I probably benign Het
Pard3 A G 8: 127,073,290 probably null Het
Pgm1 C T 5: 64,105,832 A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 S1144R probably damaging Het
Prkcq C T 2: 11,299,416 P590L probably damaging Het
Rab3gap1 T A 1: 127,889,194 D63E probably benign Het
Rag2 C A 2: 101,630,740 T465K probably damaging Het
Rnase6 A G 14: 51,130,213 M21V unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,638,430 probably null Het
Sash1 T G 10: 8,740,225 R624S probably damaging Het
Slc1a2 A G 2: 102,756,115 I355V probably benign Het
Srrm2 T C 17: 23,817,384 S1097P probably benign Het
Sugct C T 13: 17,323,276 A271T probably damaging Het
Tdrd7 T C 4: 46,034,350 V1065A probably damaging Het
Tmprss6 T A 15: 78,454,189 Y307F probably damaging Het
Tram1 T C 1: 13,571,902 N216S probably benign Het
Ttk T C 9: 83,839,341 V93A probably benign Het
Ubr4 A G 4: 139,468,097 Y1210C probably damaging Het
Wdr7 A G 18: 63,738,866 K364E probably benign Het
Xrcc2 G T 5: 25,692,658 H98N probably benign Het
Zdhhc11 A G 13: 73,965,569 I77V probably benign Het
Zfp54 C T 17: 21,434,180 S312L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Psmd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Psmd13 APN 7 140897621 missense probably damaging 0.97
IGL02265:Psmd13 APN 7 140882518 missense probably damaging 1.00
R0326:Psmd13 UTSW 7 140897711 missense probably damaging 1.00
R1163:Psmd13 UTSW 7 140897454 missense probably damaging 0.97
R1667:Psmd13 UTSW 7 140890609 missense probably damaging 1.00
R1721:Psmd13 UTSW 7 140883517 missense probably damaging 1.00
R1867:Psmd13 UTSW 7 140883517 missense probably damaging 1.00
R1993:Psmd13 UTSW 7 140898194 missense probably damaging 1.00
R2070:Psmd13 UTSW 7 140897648 missense probably damaging 0.99
R2844:Psmd13 UTSW 7 140897740 intron probably benign
R2845:Psmd13 UTSW 7 140897740 intron probably benign
R2846:Psmd13 UTSW 7 140897740 intron probably benign
R2869:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R2869:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R2871:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R2871:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R4358:Psmd13 UTSW 7 140889505 intron probably benign
R4973:Psmd13 UTSW 7 140886853 nonsense probably null
R6700:Psmd13 UTSW 7 140890609 missense probably damaging 1.00
R8239:Psmd13 UTSW 7 140886537 missense probably damaging 1.00
Z1176:Psmd13 UTSW 7 140882426 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGGAACATCAGTAAATCCCG -3'
(R):5'- TCCAACCTAATGAGCAGAGGC -3'

Sequencing Primer
(F):5'- TGGAACATCAGTAAATCCCGTTTCAC -3'
(R):5'- CAGGTAAGAGTGGGGCCCTG -3'
Posted On2017-03-16