Mutagenetix > Incidental Mutations

Incidental Mutation 'R5209:Ptprr'

470593

Institutional Source

Beutler Lab

Gene Symbol

Ptprr

Ensembl Gene

ENSMUSG00000020151

Gene Name

protein tyrosine phosphatase, receptor type, R

Synonyms

PTPBR7, PTP-SL, RPTPRR

MMRRC Submission

042784-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.385) question?

Stock #

R5209 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

116018213-116274932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116162609 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 208 (E208V)

Ref Sequence

ENSEMBL: ENSMUSP00000064392 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271]

Predicted Effect

probably damaging
Transcript: ENSMUST00000063470
AA Change: E208V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: E208V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
transmembrane domain	226	248	N/A	INTRINSIC
PTPc	391	648	3.74e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105271
AA Change: E101V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: E101V

Domain	Start	End	E-Value	Type
transmembrane domain	119	141	N/A	INTRINSIC
PTPc	284	541	3.74e-108	SMART

Meta Mutation Damage Score

0.0861

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,283,818	T4453A	possibly damaging	Het
Abca14	T	C	7: 120,232,907	V500A	probably benign	Het
Abcg4	A	G	9: 44,275,375	Y491H	probably damaging	Het
Adgb	C	A	10: 10,398,937	V759L	possibly damaging	Het
Adprhl1	T	A	8: 13,242,563	K243*	probably null	Het
Arhgap24	T	A	5: 102,892,149	D317E	probably benign	Het
Arhgef5	A	T	6: 43,273,700	I462F	probably benign	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Btbd18	A	G	2: 84,668,099	T694A	possibly damaging	Het
Ces1d	A	T	8: 93,175,188		probably benign	Het
Chmp2a	C	A	7: 13,032,674	V106F	probably damaging	Het
Cinp	T	C	12: 110,874,060	E219G	probably benign	Het
Col5a3	C	T	9: 20,778,643		probably benign	Het
Dnhd1	T	G	7: 105,696,460	S2271A	probably benign	Het
Epg5	T	A	18: 77,951,282	L376H	probably damaging	Het
Fam81a	T	C	9: 70,125,160	T17A	probably benign	Het
Fgd2	T	A	17: 29,368,376		probably null	Het
Gjc3	C	T	5: 137,957,271	V251I	probably benign	Het
Gnaz	T	G	10: 74,991,991	F192V	probably benign	Het
Hmgcr	T	C	13: 96,666,512		probably benign	Het
Mamdc4	G	T	2: 25,566,923	A614E	probably damaging	Het
Mapk8ip2	A	T	15: 89,459,287	Q713L	probably damaging	Het
Mettl1	T	C	10: 127,045,334	V238A	possibly damaging	Het
Ms4a4c	G	A	19: 11,416,438	G74E	probably damaging	Het
Msh3	A	G	13: 92,344,954		probably null	Het
Mtmr14	T	A	6: 113,253,775	Y113*	probably null	Het
Mylk	T	C	16: 34,922,625	L1169P	possibly damaging	Het
Npr3	A	G	15: 11,848,603	V426A	possibly damaging	Het
Olfr105-ps	T	C	17: 37,382,830	S88P	probably damaging	Het
Olfr221	T	C	14: 52,035,953	T53A	probably benign	Het
Olfr771	A	C	10: 129,160,932	D17E	possibly damaging	Het
Olfr905	T	A	9: 38,473,521	M258K	possibly damaging	Het
Pcdhb17	T	C	18: 37,487,461	F768S	probably damaging	Het
Piezo2	T	C	18: 63,032,929	N2077S	probably damaging	Het
Pkd1l2	G	A	8: 117,056,442	P713L	probably benign	Het
Primpol	T	C	8: 46,590,260	T333A	probably benign	Het
Pth2r	A	T	1: 65,388,697	T510S	probably benign	Het
Rag1	T	C	2: 101,644,215	Y194C	probably benign	Het
Reep5	A	T	18: 34,357,240		probably null	Het
Rexo5	T	A	7: 119,834,299	Y493*	probably null	Het
Rgs9	T	C	11: 109,239,594		probably null	Het
Rps6ka1	A	T	4: 133,865,818	V218D	probably damaging	Het
Satb1	A	T	17: 51,809,207	M16K	probably benign	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slfn14	A	G	11: 83,279,633	F395S	possibly damaging	Het
Sptbn5	T	A	2: 120,072,002	I82F	probably benign	Het
Stam	T	A	2: 14,146,347	I505K	probably benign	Het
Tesk2	G	A	4: 116,724,698		probably benign	Het
Trappc12	T	C	12: 28,737,794	K430R	probably benign	Het
Trmo	T	C	4: 46,387,740	N34D	probably damaging	Het
Ubr2	C	A	17: 46,968,424	C686F	probably damaging	Het
Vdac1	C	T	11: 52,376,452	T60I	probably damaging	Het
Zfp652	G	C	11: 95,763,665	R478P	possibly damaging	Het

Other mutations in Ptprr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Ptprr	APN	10	116188317	missense	probably benign	0.00
IGL01762:Ptprr	APN	10	116236733	missense	probably damaging	1.00
IGL02429:Ptprr	APN	10	116273767	missense	probably damaging	0.99
IGL03396:Ptprr	APN	10	116188330	missense	probably damaging	1.00
R0268:Ptprr	UTSW	10	116252963	missense	possibly damaging	0.83
R0584:Ptprr	UTSW	10	116251158	missense	probably damaging	0.96
R1388:Ptprr	UTSW	10	116273752	missense	probably benign	0.14
R1438:Ptprr	UTSW	10	116256204	missense	probably damaging	0.98
R1533:Ptprr	UTSW	10	116188208	nonsense	probably null
R1654:Ptprr	UTSW	10	116188363	missense	probably benign	0.43
R1793:Ptprr	UTSW	10	116252922	missense	probably damaging	1.00
R4081:Ptprr	UTSW	10	116236710	missense	probably benign	0.01
R4193:Ptprr	UTSW	10	116252864	missense	probably damaging	1.00
R4254:Ptprr	UTSW	10	116162443	splice site	probably null
R4496:Ptprr	UTSW	10	116229502	missense	possibly damaging	0.91
R4799:Ptprr	UTSW	10	116048218	missense	probably benign	0.00
R5312:Ptprr	UTSW	10	116188419	missense	probably benign	0.28
R5410:Ptprr	UTSW	10	116188330	missense	possibly damaging	0.94
R5556:Ptprr	UTSW	10	116251149	missense	probably damaging	0.96
R5717:Ptprr	UTSW	10	116048113	missense	probably benign	0.11
R6039:Ptprr	UTSW	10	116236763	splice site	probably null
R6039:Ptprr	UTSW	10	116236763	splice site	probably null
R7013:Ptprr	UTSW	10	116236754	missense	probably damaging	1.00
R7401:Ptprr	UTSW	10	116048236	missense	probably benign
R7527:Ptprr	UTSW	10	116251199	missense	probably benign	0.08
R7644:Ptprr	UTSW	10	116048228	missense	probably benign	0.00
R7651:Ptprr	UTSW	10	116251179	missense	probably benign	0.01
R7708:Ptprr	UTSW	10	116162597	missense	probably benign	0.31
R7731:Ptprr	UTSW	10	116237295	missense	probably damaging	1.00
R8026:Ptprr	UTSW	10	116048170	missense	probably damaging	1.00
R8261:Ptprr	UTSW	10	116237264	missense	possibly damaging	0.95
R8358:Ptprr	UTSW	10	116048275	missense	probably benign	0.25
R8387:Ptprr	UTSW	10	116251125	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACAGGCGAAAACTTTACCCG -3'
(R):5'- AAGCTGAAGTGGACTGGATTCTG -3'

Sequencing Primer
(F):5'- TTTACCCGACTCCTGAAAGATG -3'
(R):5'- AGCATGTGGTGCTAACTG -3'

Posted On

2017-03-20