Incidental Mutation 'R5140:Abcb1a'
ID470596
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1A
SynonymsPgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
MMRRC Submission 042726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R5140 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8660077-8748575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8702154 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 405 (I405N)
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
PDB Structure
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000047753
AA Change: I405N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584
AA Change: I405N

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Meta Mutation Damage Score 0.6200 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T C 19: 21,684,181 L244P probably damaging Het
Aebp2 T A 6: 140,633,806 C34* probably null Het
Arhgap33 A G 7: 30,528,301 V491A probably damaging Het
Cacul1 C T 19: 60,563,181 R201Q probably benign Het
Cald1 T A 6: 34,753,580 N77K probably damaging Het
Clcn6 A C 4: 148,038,317 probably benign Het
Copb1 A T 7: 114,246,800 H178Q probably benign Het
Dnah17 C T 11: 118,086,945 V1854I probably damaging Het
Dnajc16 T G 4: 141,764,683 T610P possibly damaging Het
Enpp1 T C 10: 24,652,852 N624S possibly damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Foxn1 T C 11: 78,361,633 T310A probably benign Het
Galnt16 T A 12: 80,581,299 D256E possibly damaging Het
Gbp11 T C 5: 105,331,053 D173G probably damaging Het
Glmn A G 5: 107,570,200 S284P probably damaging Het
Gm3985 A G 8: 32,890,665 noncoding transcript Het
Hs3st6 A T 17: 24,758,547 M334L probably benign Het
Idua T A 5: 108,680,314 D155E probably damaging Het
Kdm6b T C 11: 69,400,055 probably benign Het
Kiss1r T C 10: 79,921,627 F272L probably damaging Het
Krt35 T C 11: 100,094,517 K233E probably damaging Het
Krt36 C T 11: 100,103,502 V250M probably damaging Het
Lhpp T C 7: 132,705,632 Y253H probably damaging Het
Npas3 T A 12: 53,501,114 L51* probably null Het
Olfr1224-ps1 T C 2: 89,157,107 K23E probably benign Het
Olfr1247 T C 2: 89,609,283 Y273C probably damaging Het
Olfr347 T A 2: 36,734,498 M59K possibly damaging Het
Olfr455 T C 6: 42,538,515 H169R probably benign Het
Olfr661 T C 7: 104,688,900 M295T probably benign Het
Pcdhb9 T G 18: 37,401,133 V60G probably benign Het
Prkce T C 17: 86,482,142 V239A probably benign Het
Ralgapa1 C T 12: 55,665,674 R1804Q probably damaging Het
Ralgapa1 C T 12: 55,776,152 C293Y probably damaging Het
Rnf26 C A 9: 44,112,774 probably null Het
Safb2 T C 17: 56,577,901 D178G probably benign Het
Scn9a C T 2: 66,565,167 V178M possibly damaging Het
Sergef A G 7: 46,635,602 probably benign Het
Serpinb9 G A 13: 33,006,561 G7R probably benign Het
Setd2 C A 9: 110,551,129 D1337E probably benign Het
Shprh T A 10: 11,154,705 M222K probably benign Het
Slc25a40 T C 5: 8,430,486 Y79H probably damaging Het
Slc41a2 A G 10: 83,297,291 M297T probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spcs1 A G 14: 31,000,613 L83S probably benign Het
Sult1c1 T C 17: 53,969,715 N106S probably benign Het
Szt2 C T 4: 118,386,981 R1309Q possibly damaging Het
Ube3c T A 5: 29,635,711 F695I probably damaging Het
Uimc1 A G 13: 55,075,517 L314P probably damaging Het
Usp17le C T 7: 104,769,438 E166K probably damaging Het
Vmn2r92 G A 17: 18,152,050 D41N probably benign Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8686257 missense probably benign 0.01
IGL00898:Abcb1a APN 5 8733690 missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8732388 missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8674687 missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8702550 missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8698637 missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8715065 critical splice donor site probably null
IGL01820:Abcb1a APN 5 8715896 splice site probably benign
IGL02499:Abcb1a APN 5 8726807 missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8723245 splice site probably null
IGL02954:Abcb1a APN 5 8732341 missense probably benign 0.00
IGL03018:Abcb1a APN 5 8702451 missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8714887 missense probably benign 0.00
IGL03292:Abcb1a APN 5 8715827 missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8694153 missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8713281 missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8698535 missense probably benign 0.01
R0595:Abcb1a UTSW 5 8740417 missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8698539 missense probably benign 0.13
R0811:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8674856 splice site probably benign
R0948:Abcb1a UTSW 5 8740621 splice site probably null
R1292:Abcb1a UTSW 5 8713343 missense probably benign 0.00
R1318:Abcb1a UTSW 5 8701621 missense probably benign 0.31
R1459:Abcb1a UTSW 5 8702920 missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8686300 critical splice donor site probably null
R1514:Abcb1a UTSW 5 8674791 missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8713202 missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8738747 missense probably benign 0.30
R2844:Abcb1a UTSW 5 8686164 missense probably benign 0.02
R3709:Abcb1a UTSW 5 8738738 missense probably benign 0.03
R3755:Abcb1a UTSW 5 8747403 missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8715068 splice site probably null
R4401:Abcb1a UTSW 5 8702390 missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8719981 splice site probably benign
R4539:Abcb1a UTSW 5 8715793 missense probably benign
R4635:Abcb1a UTSW 5 8714927 missense probably benign
R4740:Abcb1a UTSW 5 8702280 critical splice donor site probably null
R4757:Abcb1a UTSW 5 8737632 missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8715732 splice site probably null
R4792:Abcb1a UTSW 5 8746657 critical splice donor site probably null
R4829:Abcb1a UTSW 5 8723214 missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8737773 critical splice donor site probably null
R5181:Abcb1a UTSW 5 8714937 missense probably benign
R5355:Abcb1a UTSW 5 8726873 missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8702946 missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8674818 missense probably benign
R5557:Abcb1a UTSW 5 8714949 missense probably benign 0.01
R5572:Abcb1a UTSW 5 8715108 intron probably null
R5702:Abcb1a UTSW 5 8737752 missense probably benign 0.15
R5753:Abcb1a UTSW 5 8723160 missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8683426 missense probably benign 0.01
R5895:Abcb1a UTSW 5 8702216 missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8719030 missense probably benign 0.01
R6555:Abcb1a UTSW 5 8702468 missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8732364 missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8701628 missense probably benign 0.28
R7000:Abcb1a UTSW 5 8702823 missense probably benign 0.19
R7102:Abcb1a UTSW 5 8694072 missense probably benign 0.01
R7172:Abcb1a UTSW 5 8702399 missense probably benign 0.00
R7313:Abcb1a UTSW 5 8723187 missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8715771 nonsense probably null
R7718:Abcb1a UTSW 5 8715788 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTCGAAAAGAAGTTCAGG -3'
(R):5'- CCTGGAACAAAGCATGTGGTG -3'

Sequencing Primer
(F):5'- TCTCGAAAAGAAGTTCAGGTAAGATG -3'
(R):5'- ACAAAGCATGTGGTGTTCAC -3'
Posted On2017-03-20