Mutagenetix > Incidental Mutations

Incidental Mutation 'R5156:Sp100'

470606

Institutional Source

Beutler Lab

Gene Symbol

Sp100

Ensembl Gene

ENSMUSG00000026222

Gene Name

nuclear antigen Sp100

Synonyms

MMRRC Submission

042738-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85649988-85709998 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85673683 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 241 (D241E)

Ref Sequence

ENSEMBL: ENSMUSP00000118481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054279] [ENSMUST00000066427] [ENSMUST00000145440] [ENSMUST00000147552] [ENSMUST00000150967] [ENSMUST00000153574] [ENSMUST00000155094]

Predicted Effect

probably damaging
Transcript: ENSMUST00000054279
AA Change: D241E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222
AA Change: D241E

Domain	Start	End	E-Value	Type
Pfam:Sp100	19	122	4.9e-47	PFAM
low complexity region	334	345	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066427
AA Change: D241E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222
AA Change: D241E

Domain	Start	End	E-Value	Type
Pfam:Sp100	21	119	3.4e-40	PFAM
low complexity region	320	335	N/A	INTRINSIC
low complexity region	367	377	N/A	INTRINSIC
SAND	386	459	8.85e-38	SMART
BROMO	473	573	1.16e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082480

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140758

Predicted Effect

probably damaging
Transcript: ENSMUST00000145440
AA Change: D241E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222
AA Change: D241E

Domain	Start	End	E-Value	Type
Pfam:Sp100	19	122	3.7e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000147552
AA Change: D241E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222
AA Change: D241E

Domain	Start	End	E-Value	Type
Pfam:Sp100	19	122	2.5e-46	PFAM
low complexity region	305	319	N/A	INTRINSIC
low complexity region	349	359	N/A	INTRINSIC
SAND	368	441	8.85e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000150967
AA Change: D241E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222
AA Change: D241E

Domain	Start	End	E-Value	Type
Pfam:Sp100	19	122	2.1e-46	PFAM
low complexity region	324	334	N/A	INTRINSIC
SAND	343	416	8.85e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000153574
AA Change: D241E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222
AA Change: D241E

Domain	Start	End	E-Value	Type
Pfam:Sp100	19	122	9.2e-47	PFAM
low complexity region	342	352	N/A	INTRINSIC
SAND	361	434	8.85e-38	SMART
Blast:BROMO	453	476	9e-6	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000155094
AA Change: D241E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222
AA Change: D241E

Domain	Start	End	E-Value	Type
Pfam:Sp100	19	122	1.6e-46	PFAM
low complexity region	320	335	N/A	INTRINSIC
low complexity region	367	377	N/A	INTRINSIC
SAND	386	459	8.85e-38	SMART

Meta Mutation Damage Score

0.0782

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Sp100

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01082:Sp100	APN	1	85670020	missense	possibly damaging	0.48
IGL01998:Sp100	APN	1	85666929	missense	probably benign	0.01
IGL02192:Sp100	APN	1	85708001	missense	probably damaging	0.99
IGL02809:Sp100	APN	1	85681124	missense	probably damaging	0.99
IGL03274:Sp100	APN	1	85707304	intron	probably benign
PIT4458001:Sp100	UTSW	1	85708116	missense	probably benign	0.10
R0115:Sp100	UTSW	1	85650131	splice site	probably benign
R0599:Sp100	UTSW	1	85681110	missense	possibly damaging	0.68
R0620:Sp100	UTSW	1	85659867	splice site	probably null
R0693:Sp100	UTSW	1	85667005	critical splice donor site	probably null
R0709:Sp100	UTSW	1	85694281	missense	probably damaging	0.96
R0744:Sp100	UTSW	1	85699744	missense	probably damaging	0.97
R0836:Sp100	UTSW	1	85699744	missense	probably damaging	0.97
R1175:Sp100	UTSW	1	85701420	missense	possibly damaging	0.83
R1496:Sp100	UTSW	1	85663521	splice site	probably benign
R1749:Sp100	UTSW	1	85699636	missense	possibly damaging	0.95
R2046:Sp100	UTSW	1	85709065	missense	possibly damaging	0.53
R2069:Sp100	UTSW	1	85681142	splice site	probably null
R2441:Sp100	UTSW	1	85703489	unclassified	probably benign
R3933:Sp100	UTSW	1	85681109	missense	probably benign	0.29
R4171:Sp100	UTSW	1	85706841	missense	probably benign	0.00
R4762:Sp100	UTSW	1	85701458	makesense	probably null
R4863:Sp100	UTSW	1	85705003	missense	probably benign	0.03
R5273:Sp100	UTSW	1	85709104	missense	possibly damaging	0.86
R5635:Sp100	UTSW	1	85682264	intron	probably benign
R5810:Sp100	UTSW	1	85665285	missense	probably benign	0.12
R5910:Sp100	UTSW	1	85681140	critical splice donor site	probably null
R5931:Sp100	UTSW	1	85679083	missense	probably damaging	1.00
R7466:Sp100	UTSW	1	85707239	missense	possibly damaging	0.93
R7514:Sp100	UTSW	1	85681139	nonsense	probably null
R7647:Sp100	UTSW	1	85692043	missense	possibly damaging	0.91
R7851:Sp100	UTSW	1	85706926	missense	probably benign	0.12
R7908:Sp100	UTSW	1	85708067	missense	possibly damaging	0.51
R8064:Sp100	UTSW	1	85681139	nonsense	probably null
R8094:Sp100	UTSW	1	85697098	missense	possibly damaging	0.95
R8757:Sp100	UTSW	1	85662564	missense	possibly damaging	0.92
R8785:Sp100	UTSW	1	85699751	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAAGAGGGATCATTCATGGTATTC -3'
(R):5'- ACTATGTGGGCTACCTCAAGG -3'

Sequencing Primer
(F):5'- AAATGGCTGCCACTTATGCG -3'
(R):5'- GGTCCCTGATAACATATGTAATCCC -3'

Posted On

2017-03-23