Mutagenetix > Incidental Mutations

Incidental Mutation 'R5156:Ppef2'

470608

Institutional Source

Beutler Lab

Gene Symbol

Ppef2

Ensembl Gene

ENSMUSG00000029410

Gene Name

protein phosphatase, EF hand calcium-binding domain 2

Synonyms

MMRRC Submission

042738-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92226679-92256278 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 92244602 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000031359] [ENSMUST00000201130] [ENSMUST00000201130]

Predicted Effect

probably null
Transcript: ENSMUST00000031359

SMART Domains

Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000031359

SMART Domains

Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000201130

SMART Domains

Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000201130

SMART Domains

Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Ppef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ppef2	APN	5	92234237	missense	probably damaging	1.00
IGL01105:Ppef2	APN	5	92249196	missense	possibly damaging	0.91
IGL01613:Ppef2	APN	5	92235820	missense	probably benign	0.01
IGL01793:Ppef2	APN	5	92246756	missense	probably damaging	1.00
IGL02529:Ppef2	APN	5	92244737	missense	probably damaging	1.00
IGL02702:Ppef2	APN	5	92231819	missense	probably benign	0.01
IGL02992:Ppef2	APN	5	92235900	nonsense	probably null
IGL02995:Ppef2	APN	5	92235900	nonsense	probably null
IGL02996:Ppef2	APN	5	92235900	nonsense	probably null
IGL03169:Ppef2	APN	5	92235900	nonsense	probably null
IGL02991:Ppef2	UTSW	5	92235900	nonsense	probably null
R0494:Ppef2	UTSW	5	92253093	splice site	probably benign
R0659:Ppef2	UTSW	5	92230509	missense	probably damaging	1.00
R0781:Ppef2	UTSW	5	92244830	missense	probably benign	0.39
R1162:Ppef2	UTSW	5	92253121	missense	probably benign	0.00
R1870:Ppef2	UTSW	5	92250512	missense	probably damaging	1.00
R2212:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R2973:Ppef2	UTSW	5	92239094	missense	probably benign
R3412:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3413:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3745:Ppef2	UTSW	5	92239151	splice site	probably benign
R4878:Ppef2	UTSW	5	92228740	splice site	probably null
R5027:Ppef2	UTSW	5	92234291	missense	probably damaging	1.00
R5316:Ppef2	UTSW	5	92235811	missense	probably benign	0.00
R5590:Ppef2	UTSW	5	92239139	missense	probably damaging	0.99
R5773:Ppef2	UTSW	5	92250561	missense	probably damaging	1.00
R5881:Ppef2	UTSW	5	92250529	nonsense	probably null
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6182:Ppef2	UTSW	5	92227066	missense	probably damaging	1.00
R6335:Ppef2	UTSW	5	92235754	missense	probably damaging	1.00
R6645:Ppef2	UTSW	5	92230461	missense	probably benign	0.02
R7448:Ppef2	UTSW	5	92228704	missense	probably damaging	1.00
R7576:Ppef2	UTSW	5	92253134	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TGCTAAAGGGCAGTGATTGG -3'
(R):5'- ACAGTTCGGTGAAGCTGAATAG -3'

Sequencing Primer
(F):5'- GACTGCTCTTACAAAGGTCCTGAG -3'
(R):5'- AGGACACTTCAGGATGTC -3'

Posted On

2017-03-23