Incidental Mutation 'R5180:Ankrd35'
Institutional Source Beutler Lab
Gene Symbol Ankrd35
Ensembl Gene ENSMUSG00000038354
Gene Nameankyrin repeat domain 35
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosomal Location96670131-96691032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96680473 bp
Amino Acid Change Histidine to Glutamine at position 109 (H109Q)
Ref Sequence ENSEMBL: ENSMUSP00000047244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048427] [ENSMUST00000122960]
Predicted Effect probably damaging
Transcript: ENSMUST00000048427
AA Change: H109Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047244
Gene: ENSMUSG00000038354
AA Change: H109Q

ANK 53 82 4.03e-5 SMART
ANK 86 115 6.46e-4 SMART
ANK 119 148 4.36e-1 SMART
ANK 152 181 1.4e-4 SMART
ANK 185 214 2.25e-3 SMART
ANK 218 247 6.24e2 SMART
coiled coil region 294 339 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
coiled coil region 606 653 N/A INTRINSIC
coiled coil region 729 799 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 847 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130429
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Ankrd35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Ankrd35 APN 3 96683034 splice site probably null
IGL00896:Ankrd35 APN 3 96684276 missense probably damaging 1.00
IGL01565:Ankrd35 APN 3 96684785 missense probably damaging 0.99
IGL01837:Ankrd35 APN 3 96680666 missense probably damaging 1.00
IGL02605:Ankrd35 APN 3 96681072 splice site probably null
IGL02819:Ankrd35 APN 3 96690208 missense possibly damaging 0.80
IGL02994:Ankrd35 APN 3 96682991 splice site probably benign
IGL03083:Ankrd35 APN 3 96684801 missense probably damaging 1.00
IGL03105:Ankrd35 APN 3 96684057 missense probably benign
FR4304:Ankrd35 UTSW 3 96683847 utr 3 prime probably benign
FR4342:Ankrd35 UTSW 3 96683515 frame shift probably null
FR4737:Ankrd35 UTSW 3 96683849 utr 3 prime probably benign
R0003:Ankrd35 UTSW 3 96684015 missense probably damaging 1.00
R0047:Ankrd35 UTSW 3 96684063 missense probably benign 0.00
R0551:Ankrd35 UTSW 3 96683960 missense probably benign 0.08
R1420:Ankrd35 UTSW 3 96684738 missense probably benign 0.13
R1455:Ankrd35 UTSW 3 96678155 missense probably damaging 1.00
R2201:Ankrd35 UTSW 3 96679248 missense possibly damaging 0.93
R3522:Ankrd35 UTSW 3 96685062 missense probably damaging 1.00
R3605:Ankrd35 UTSW 3 96682181 nonsense probably null
R4166:Ankrd35 UTSW 3 96679155 splice site probably null
R4651:Ankrd35 UTSW 3 96684027 missense probably benign 0.00
R4668:Ankrd35 UTSW 3 96679208 missense probably damaging 1.00
R4916:Ankrd35 UTSW 3 96684122 missense probably benign
R4921:Ankrd35 UTSW 3 96684824 missense possibly damaging 0.61
R4953:Ankrd35 UTSW 3 96683673 missense possibly damaging 0.56
R5583:Ankrd35 UTSW 3 96684903 missense probably damaging 1.00
R5604:Ankrd35 UTSW 3 96684899 missense probably benign 0.02
R5613:Ankrd35 UTSW 3 96683018 missense possibly damaging 0.76
R6165:Ankrd35 UTSW 3 96683307 missense possibly damaging 0.93
R6413:Ankrd35 UTSW 3 96684813 missense probably damaging 0.96
R6711:Ankrd35 UTSW 3 96683468 nonsense probably null
R6834:Ankrd35 UTSW 3 96683283 missense possibly damaging 0.68
R6841:Ankrd35 UTSW 3 96670426 missense probably damaging 1.00
R7028:Ankrd35 UTSW 3 96683334 missense possibly damaging 0.92
R7396:Ankrd35 UTSW 3 96683497 missense probably damaging 1.00
R7425:Ankrd35 UTSW 3 96684788 missense not run
R7815:Ankrd35 UTSW 3 96684801 missense probably damaging 1.00
R7887:Ankrd35 UTSW 3 96684900 missense probably damaging 1.00
R8103:Ankrd35 UTSW 3 96679681 missense possibly damaging 0.93
R8318:Ankrd35 UTSW 3 96684722 missense probably damaging 1.00
Z1177:Ankrd35 UTSW 3 96683770 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-03-29