Incidental Mutation 'R5180:Grhl3'
ID 470622
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Name grainyhead like transcription factor 3
Synonyms Som, ct, Get1
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock # R5180 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 135541888-135573630 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 135559104 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 89 (K89*)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
AlphaFold Q5FWH3
Predicted Effect probably null
Transcript: ENSMUST00000105855
AA Change: K89*
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: K89*

Pfam:CP2 215 421 2.5e-81 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135556865 missense probably benign 0.00
IGL02868:Grhl3 APN 4 135554604 missense probably damaging 1.00
Bite-size UTSW 4 135557433 missense possibly damaging 0.46
hammerkop UTSW 4 135546246 missense probably damaging 1.00
hoopoe UTSW 4 135559146 missense probably benign 0.00
Tropicbird UTSW 4 135559104 nonsense probably null
R0121:Grhl3 UTSW 4 135552549 missense probably damaging 0.97
R0180:Grhl3 UTSW 4 135554530 missense probably benign 0.00
R0627:Grhl3 UTSW 4 135552681 missense probably benign 0.18
R0727:Grhl3 UTSW 4 135546254 missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135561306 missense probably benign 0.01
R1664:Grhl3 UTSW 4 135552550 missense probably benign 0.11
R2910:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R2911:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R3773:Grhl3 UTSW 4 135555847 nonsense probably null
R4033:Grhl3 UTSW 4 135573424 start codon destroyed probably benign
R4521:Grhl3 UTSW 4 135546250 missense probably damaging 1.00
R4576:Grhl3 UTSW 4 135561251 missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135549236 splice site probably null
R4697:Grhl3 UTSW 4 135548466 missense probably damaging 1.00
R4919:Grhl3 UTSW 4 135559104 nonsense probably null
R4920:Grhl3 UTSW 4 135559104 nonsense probably null
R4961:Grhl3 UTSW 4 135552607 missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135542675 missense probably benign
R5181:Grhl3 UTSW 4 135559104 nonsense probably null
R5325:Grhl3 UTSW 4 135559104 nonsense probably null
R6429:Grhl3 UTSW 4 135557196 missense probably damaging 0.99
R6459:Grhl3 UTSW 4 135557433 missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135549240 splice site probably null
R7073:Grhl3 UTSW 4 135573412 missense probably benign 0.00
R7345:Grhl3 UTSW 4 135546246 missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135559105 missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135561221 missense probably damaging 0.98
R8023:Grhl3 UTSW 4 135550329 missense probably benign
R8472:Grhl3 UTSW 4 135556865 missense probably benign 0.00
R8499:Grhl3 UTSW 4 135549238 critical splice donor site probably null
R8766:Grhl3 UTSW 4 135573413 missense probably benign 0.00
R8836:Grhl3 UTSW 4 135561329 missense probably damaging 1.00
R9466:Grhl3 UTSW 4 135556101 missense probably benign 0.06
Z1177:Grhl3 UTSW 4 135552686 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2017-03-29