Mutagenetix > Incidental Mutation

Incidental Mutation 'R5180:Grhl3'

470622

Institutional Source

Beutler Lab

Gene Symbol

Grhl3

Ensembl Gene

ENSMUSG00000037188

Gene Name

grainyhead like transcription factor 3

Synonyms

Som, ct, Get1

MMRRC Submission

042760-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R5180 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135541888-135573630 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 135559104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 89 (K89*)

Ref Sequence

ENSEMBL: ENSMUSP00000101481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105855]

AlphaFold

Q5FWH3

Predicted Effect

probably null
Transcript: ENSMUST00000105855
AA Change: K89*

SMART Domains

Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: K89*

Domain	Start	End	E-Value	Type
Pfam:CP2	215	421	2.5e-81	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,466,510	T4091A	probably benign	Het
Adgrv1	G	A	13: 81,283,416		probably benign	Het
Ago3	C	T	4: 126,367,751	V435I	probably benign	Het
Akap10	C	T	11: 61,916,189	A72T	probably damaging	Het
Ampd2	G	T	3: 108,079,042	Q273K	probably benign	Het
Ankrd35	C	A	3: 96,680,473	H109Q	probably damaging	Het
Atpaf2	A	G	11: 60,405,869	L153S	possibly damaging	Het
C1qtnf7	G	A	5: 43,615,814	V152M	probably benign	Het
Ccnb1	C	G	13: 100,781,775	Q121H	possibly damaging	Het
Cep295	C	T	9: 15,332,120	C1680Y	probably benign	Het
Cyp4f15	A	T	17: 32,690,740	I104F	probably benign	Het
Daam1	A	G	12: 71,947,125	N434S	unknown	Het
Dab2ip	C	T	2: 35,720,491	P782L	possibly damaging	Het
Dhx34	C	A	7: 16,205,480	G663*	probably null	Het
Dnah7a	T	C	1: 53,423,287	D3715G	probably damaging	Het
Dnajc11	C	T	4: 151,969,939	R201C	probably damaging	Het
Erf	A	T	7: 25,246,265	I27N	probably damaging	Het
Fbxl7	T	A	15: 26,543,421	Y380F	probably damaging	Het
Gm3336	A	G	8: 70,720,461		probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm5134	T	C	10: 75,976,366	Y152H	probably damaging	Het
Gm6899	A	G	11: 26,593,795		probably benign	Het
Gna11	T	C	10: 81,544,873	K19E	probably benign	Het
Gpr15	C	A	16: 58,717,885	L280F	probably benign	Het
Ino80d	C	A	1: 63,086,329		probably benign	Het
Irak3	T	G	10: 120,145,782	K406T	probably damaging	Het
Kif15	G	A	9: 122,999,210	C634Y	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Macrod2	A	T	2: 140,395,716	E14V	probably damaging	Het
Matn3	T	A	12: 8,955,374	D261E	probably benign	Het
Mdga1	A	T	17: 29,857,736		probably benign	Het
Natd1	G	T	11: 60,913,656	R24S	probably benign	Het
Ncapd3	T	A	9: 27,051,645	D415E	possibly damaging	Het
Olfr1453	A	T	19: 13,027,412	S306T	probably benign	Het
Parp9	T	A	16: 35,953,736	Y81*	probably null	Het
Pde4d	A	G	13: 109,740,473	N73S	probably benign	Het
Pigb	A	T	9: 73,034,590	I129N	probably damaging	Het
Plxnb1	C	A	9: 109,111,693		probably null	Het
Ppfibp1	G	T	6: 147,027,321	R813L	probably damaging	Het
Ramp3	T	A	11: 6,658,619	L16Q	unknown	Het
Slc35a4	T	C	18: 36,682,635	S173P	probably benign	Het
Slc41a1	T	C	1: 131,844,377	V415A	probably damaging	Het
Smarcc2	CCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGC	10: 128,487,362		probably benign	Het
Snph	G	A	2: 151,600,387	R43W	probably benign	Het
Sptan1	A	T	2: 29,993,724		probably benign	Het
Supt20	C	A	3: 54,709,085	H254Q	probably benign	Het
Taar7a	A	G	10: 23,993,148	C112R	probably damaging	Het
Tbc1d4	T	C	14: 101,507,572	Y206C	probably damaging	Het
Tecta	A	G	9: 42,337,208	V1961A	probably damaging	Het
Tgfbr1	T	A	4: 47,383,948	Y30*	probably null	Het
Tmem71	C	T	15: 66,555,214	S44N	probably benign	Het
Tnfrsf1b	C	A	4: 145,227,497	C94F	probably damaging	Het
Ttn	A	G	2: 76,749,396	Y23718H	probably damaging	Het
Ube2i	T	C	17: 25,265,294		probably benign	Het
Vmn2r16	G	T	5: 109,330,525	V49F	probably benign	Het
Vps45	A	G	3: 96,046,371	I223T	possibly damaging	Het
Zfp955a	T	C	17: 33,242,618	Y180C	probably benign	Het
Zhx1	C	G	15: 58,054,074	G259R	probably damaging	Het
Zscan18	T	A	7: 12,775,289		probably benign	Het

Other mutations in Grhl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02638:Grhl3	APN	4	135556865	missense	probably benign	0.00
IGL02868:Grhl3	APN	4	135554604	missense	probably damaging	1.00
Bite-size	UTSW	4	135557433	missense	possibly damaging	0.46
hammerkop	UTSW	4	135546246	missense	probably damaging	1.00
hoopoe	UTSW	4	135559146	missense	probably benign	0.00
Tropicbird	UTSW	4	135559104	nonsense	probably null
R0121:Grhl3	UTSW	4	135552549	missense	probably damaging	0.97
R0180:Grhl3	UTSW	4	135554530	missense	probably benign	0.00
R0627:Grhl3	UTSW	4	135552681	missense	probably benign	0.18
R0727:Grhl3	UTSW	4	135546254	missense	possibly damaging	0.90
R1248:Grhl3	UTSW	4	135561306	missense	probably benign	0.01
R1664:Grhl3	UTSW	4	135552550	missense	probably benign	0.11
R2910:Grhl3	UTSW	4	135559146	missense	probably benign	0.00
R2911:Grhl3	UTSW	4	135559146	missense	probably benign	0.00
R3773:Grhl3	UTSW	4	135555847	nonsense	probably null
R4033:Grhl3	UTSW	4	135573424	start codon destroyed	probably benign
R4521:Grhl3	UTSW	4	135546250	missense	probably damaging	1.00
R4576:Grhl3	UTSW	4	135561251	missense	probably damaging	1.00
R4650:Grhl3	UTSW	4	135549236	splice site	probably null
R4697:Grhl3	UTSW	4	135548466	missense	probably damaging	1.00
R4919:Grhl3	UTSW	4	135559104	nonsense	probably null
R4920:Grhl3	UTSW	4	135559104	nonsense	probably null
R4961:Grhl3	UTSW	4	135552607	missense	probably damaging	1.00
R5100:Grhl3	UTSW	4	135542675	missense	probably benign
R5181:Grhl3	UTSW	4	135559104	nonsense	probably null
R5325:Grhl3	UTSW	4	135559104	nonsense	probably null
R6429:Grhl3	UTSW	4	135557196	missense	probably damaging	0.99
R6459:Grhl3	UTSW	4	135557433	missense	possibly damaging	0.46
R7047:Grhl3	UTSW	4	135549240	splice site	probably null
R7073:Grhl3	UTSW	4	135573412	missense	probably benign	0.00
R7345:Grhl3	UTSW	4	135546246	missense	probably damaging	1.00
R7797:Grhl3	UTSW	4	135559105	missense	possibly damaging	0.93
R7829:Grhl3	UTSW	4	135561221	missense	probably damaging	0.98
R8023:Grhl3	UTSW	4	135550329	missense	probably benign
R8472:Grhl3	UTSW	4	135556865	missense	probably benign	0.00
R8499:Grhl3	UTSW	4	135549238	critical splice donor site	probably null
R8766:Grhl3	UTSW	4	135573413	missense	probably benign	0.00
R8836:Grhl3	UTSW	4	135561329	missense	probably damaging	1.00
R9466:Grhl3	UTSW	4	135556101	missense	probably benign	0.06
Z1177:Grhl3	UTSW	4	135552686	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGGCTGTTCTGAAACCTCCC -3'
(R):5'- TTTCTCCCAAGCGTTCCAGG -3'

Sequencing Primer
(F):5'- GAAACCTCCCCATTGCACCTATTG -3'
(R):5'- AAGCGTTCCAGGGCCTG -3'

Posted On

2017-03-29