Incidental Mutation 'R0499:Erg'
ID47063
Institutional Source Beutler Lab
Gene Symbol Erg
Ensembl Gene ENSMUSG00000040732
Gene NameETS transcription factor
SynonymsD030036I24Rik
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0499 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95360204-95530365 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 95360983 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 305 (Y305*)
Ref Sequence ENSEMBL: ENSMUSP00000134930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077773] [ENSMUST00000113846] [ENSMUST00000113848] [ENSMUST00000118113] [ENSMUST00000121809] [ENSMUST00000122199] [ENSMUST00000171646] [ENSMUST00000176345] [ENSMUST00000177450]
Predicted Effect probably null
Transcript: ENSMUST00000077773
AA Change: Y404*
SMART Domains Protein: ENSMUSP00000076949
Gene: ENSMUSG00000040732
AA Change: Y404*

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 293 378 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113846
AA Change: Y428*
SMART Domains Protein: ENSMUSP00000109477
Gene: ENSMUSG00000040732
AA Change: Y428*

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 317 402 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113848
AA Change: Y428*
SMART Domains Protein: ENSMUSP00000109479
Gene: ENSMUSG00000040732
AA Change: Y428*

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 294 379 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118113
AA Change: Y398*
SMART Domains Protein: ENSMUSP00000112698
Gene: ENSMUSG00000040732
AA Change: Y398*

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 287 372 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121809
AA Change: Y404*
SMART Domains Protein: ENSMUSP00000113723
Gene: ENSMUSG00000040732
AA Change: Y404*

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 286 371 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122199
AA Change: Y398*
SMART Domains Protein: ENSMUSP00000114072
Gene: ENSMUSG00000040732
AA Change: Y398*

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 310 395 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171646
AA Change: Y381*
SMART Domains Protein: ENSMUSP00000132766
Gene: ENSMUSG00000040732
AA Change: Y381*

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 270 355 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176345
AA Change: Y421*
SMART Domains Protein: ENSMUSP00000135568
Gene: ENSMUSG00000040732
AA Change: Y421*

DomainStartEndE-ValueType
SAM_PNT 23 107 6.99e-32 SMART
ETS 218 303 9.9e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177450
AA Change: Y305*
SMART Domains Protein: ENSMUSP00000134930
Gene: ENSMUSG00000040732
AA Change: Y305*

DomainStartEndE-ValueType
SAM_PNT 23 107 6.99e-32 SMART
ETS 194 279 9.9e-58 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an ENU-induced mutation or a knock-out of isoforms 5 - 7 die during organogenesis and exhibit embryonic growth retardation. Mice homozygous for a knock-out of isoforms 1 - 4 are viable and fertile with no overt abnnormalities. Homozygous knock-out mice develop pulmonary venoocclusive disease, with pancytopenia, pulmonary hemorrhage and hypertension, and heart right ventricle hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Erg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Erg APN 16 95369989 splice site probably benign
IGL01096:Erg APN 16 95390053 splice site probably benign
IGL01446:Erg APN 16 95361282 missense probably damaging 1.00
IGL01459:Erg APN 16 95361282 missense probably damaging 1.00
IGL01984:Erg APN 16 95409927 missense probably damaging 1.00
IGL03164:Erg APN 16 95409871 missense possibly damaging 0.94
PIT4515001:Erg UTSW 16 95409760 missense probably benign 0.09
R0734:Erg UTSW 16 95370025 missense possibly damaging 0.61
R1880:Erg UTSW 16 95377309 missense probably benign 0.07
R2069:Erg UTSW 16 95361078 missense probably damaging 1.00
R4710:Erg UTSW 16 95390034 missense possibly damaging 0.92
R4749:Erg UTSW 16 95361170 missense probably damaging 1.00
R5053:Erg UTSW 16 95524534 missense probably benign 0.00
R5284:Erg UTSW 16 95459243 start codon destroyed probably null 0.01
R5694:Erg UTSW 16 95361031 missense probably benign 0.00
R6212:Erg UTSW 16 95379163 missense probably damaging 0.98
R6258:Erg UTSW 16 95380241 missense probably damaging 0.99
R6260:Erg UTSW 16 95380241 missense probably damaging 0.99
R6856:Erg UTSW 16 95368651 critical splice donor site probably null
R7426:Erg UTSW 16 95459156 intron probably null
R7549:Erg UTSW 16 95369320 critical splice donor site probably null
R7749:Erg UTSW 16 95377357 missense probably benign 0.00
Z1176:Erg UTSW 16 95361317 missense probably damaging 0.99
Z1176:Erg UTSW 16 95409750 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GGCGATTGTACACTGTTGGGAAAGG -3'
(R):5'- ACATGAACTATGACAAGCTCAGCCG -3'

Sequencing Primer
(F):5'- CTCCATCTGGTCTCTAGTAGTAGG -3'
(R):5'- GCGCCCTCCGCTACTAC -3'
Posted On2013-06-12