Incidental Mutation 'R5266:Sry'
ID470632
Institutional Source Beutler Lab
Gene Symbol Sry
Ensembl Gene ENSMUSG00000069036
Gene Namesex determining region of Chr Y
SynonymsTdy, Tdf
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R5266 (G1)
Quality Score47
Status Validated
ChromosomeY
Chromosomal Location2662471-2663658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 2662975 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 228 (Q228H)
Ref Sequence ENSEMBL: ENSMUSP00000088717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091178]
Predicted Effect unknown
Transcript: ENSMUST00000091178
AA Change: Q228H
SMART Domains Protein: ENSMUSP00000088717
Gene: ENSMUSG00000069036
AA Change: Q228H

DomainStartEndE-ValueType
HMG 4 74 2.76e-24 SMART
low complexity region 144 366 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Variations in expression of alleles on specific backgrounds result in partial and/or complete male to female sex reversal. Deletion of alleles results in XY females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Sry
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Sry UTSW Y 2662837 small insertion probably benign
FR4340:Sry UTSW Y 2662824 small insertion probably benign
FR4342:Sry UTSW Y 2662835 small insertion probably benign
FR4342:Sry UTSW Y 2662836 small insertion probably benign
FR4342:Sry UTSW Y 2662839 small insertion probably benign
FR4342:Sry UTSW Y 2663146 small deletion probably benign
FR4449:Sry UTSW Y 2662818 small insertion probably benign
FR4449:Sry UTSW Y 2662832 small insertion probably benign
FR4589:Sry UTSW Y 2662818 small insertion probably benign
FR4737:Sry UTSW Y 2662837 small insertion probably benign
FR4737:Sry UTSW Y 2662838 small insertion probably benign
FR4737:Sry UTSW Y 2663195 small deletion probably benign
FR4976:Sry UTSW Y 2662841 small insertion probably benign
R0288:Sry UTSW Y 2662818 missense unknown
R0506:Sry UTSW Y 2662864 missense unknown
R0690:Sry UTSW Y 2662944 small deletion probably benign
R0784:Sry UTSW Y 2662731 missense unknown
R1373:Sry UTSW Y 2662864 missense unknown
R1555:Sry UTSW Y 2662975 missense unknown
R1638:Sry UTSW Y 2663149 missense unknown
R2110:Sry UTSW Y 2662901 missense unknown
R2212:Sry UTSW Y 2663339 missense probably damaging 0.99
R3150:Sry UTSW Y 2662944 small deletion probably benign
R3552:Sry UTSW Y 2663141 missense unknown
R4877:Sry UTSW Y 2662864 missense unknown
R4888:Sry UTSW Y 2663105 missense unknown
R5028:Sry UTSW Y 2663312 missense probably damaging 0.97
R5305:Sry UTSW Y 2662982 missense unknown
R5335:Sry UTSW Y 2663647 missense probably benign 0.08
R5587:Sry UTSW Y 2662625 missense unknown
R5915:Sry UTSW Y 2662612 missense unknown
R6183:Sry UTSW Y 2662975 missense unknown
R6184:Sry UTSW Y 2662975 missense unknown
R6187:Sry UTSW Y 2662975 missense unknown
R6976:Sry UTSW Y 2662938 missense unknown
R7358:Sry UTSW Y 2662638 small deletion probably benign
R7632:Sry UTSW Y 2662638 small deletion probably benign
R7678:Sry UTSW Y 2663248 missense possibly damaging 0.83
R7737:Sry UTSW Y 2662638 small deletion probably benign
R7812:Sry UTSW Y 2662638 small deletion probably benign
R7829:Sry UTSW Y 2662638 small deletion probably benign
R8005:Sry UTSW Y 2663303 missense possibly damaging 0.88
R8028:Sry UTSW Y 2662638 small deletion probably benign
R8082:Sry UTSW Y 2662589 missense unknown
R8212:Sry UTSW Y 2662638 small deletion probably benign
R8223:Sry UTSW Y 2663204 missense unknown
R8252:Sry UTSW Y 2663298 missense possibly damaging 0.91
R8390:Sry UTSW Y 2662638 small deletion probably benign
R8767:Sry UTSW Y 2662638 small deletion probably benign
RF002:Sry UTSW Y 2662564 small deletion probably benign
RF006:Sry UTSW Y 2662638 small deletion probably benign
RF008:Sry UTSW Y 2662826 small insertion probably benign
RF040:Sry UTSW Y 2662590 small insertion probably benign
RF063:Sry UTSW Y 2662595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAAGTAGGTAAGCTGCTGGTC -3'
(R):5'- AGCCTGTTGATATCCCCACTG -3'

Sequencing Primer
(F):5'- AAGCTGCTGGTCGTGGAAC -3'
(R):5'- GCAGCAACAGCAGTTCTATG -3'
Posted On2017-03-31