Incidental Mutation 'R5239:Kel'
ID470634
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 042810-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5239 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 41688114 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 254 (L254*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]
Predicted Effect probably null
Transcript: ENSMUST00000031899
AA Change: L572*
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: L572*

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031900
SMART Domains Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF4717 37 107 7.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153760
Predicted Effect probably null
Transcript: ENSMUST00000192118
AA Change: L254*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Predicted Effect probably benign
Transcript: ENSMUST00000194597
SMART Domains Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
Pfam:Peptidase_M13 16 68 3.6e-10 PFAM
Meta Mutation Damage Score 0.9702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,836 N168S probably benign Het
Adam3 T A 8: 24,694,191 T598S possibly damaging Het
Ago1 G T 4: 126,441,215 H405N probably damaging Het
Atp8b4 T C 2: 126,392,861 probably null Het
Baz1a A G 12: 54,898,344 S1409P probably damaging Het
Brinp2 T C 1: 158,251,338 E305G probably benign Het
Bub1 T A 2: 127,821,696 R262W probably damaging Het
Cish T A 9: 107,299,912 probably null Het
Clip4 T A 17: 71,799,077 I85K probably damaging Het
Cpsf2 T A 12: 101,987,273 C187* probably null Het
Ddx51 C A 5: 110,653,648 T54K probably benign Het
Drc1 A T 5: 30,363,123 T603S probably benign Het
Eif3l T A 15: 79,089,795 M470K possibly damaging Het
Entpd2 A G 2: 25,400,818 T445A probably damaging Het
Epha1 C A 6: 42,365,010 V369L possibly damaging Het
Galnt9 T A 5: 110,544,769 L23H probably damaging Het
Gm1110 A G 9: 26,893,570 F399S probably benign Het
Gm43972 G A 5: 25,661,121 noncoding transcript Het
Gm6489 T A 1: 31,287,270 noncoding transcript Het
Grik5 A T 7: 25,065,470 M82K probably damaging Het
Hibch T C 1: 52,865,608 Y121H probably damaging Het
Hyou1 T A 9: 44,385,263 I495N possibly damaging Het
Il1rl2 T C 1: 40,365,095 S459P probably benign Het
Lasp1 A G 11: 97,799,860 K23E probably damaging Het
Lemd2 C A 17: 27,203,799 R207L possibly damaging Het
Mum1 C T 10: 80,228,421 R14* probably null Het
Myh1 A T 11: 67,215,225 Q1222L probably benign Het
Myh2 G A 11: 67,192,443 V1411I probably benign Het
Myo1f T C 17: 33,601,735 F851L probably benign Het
Myom3 G A 4: 135,800,992 probably benign Het
Nbas C A 12: 13,441,518 L1464I probably benign Het
Nr2e3 G T 9: 59,949,776 probably benign Het
Nrxn1 T C 17: 90,704,109 D364G probably damaging Het
Olfr1015 T G 2: 85,785,658 I49S probably damaging Het
Olfr1385 A G 11: 49,494,728 H65R possibly damaging Het
Olfr493 T A 7: 108,346,646 T112S probably benign Het
Olfr969 T A 9: 39,796,196 S274T probably damaging Het
Otog T A 7: 46,287,435 S1523T probably benign Het
Pcnx2 A T 8: 125,861,082 probably null Het
Pkdcc C A 17: 83,215,984 H173Q probably damaging Het
Pkn1 A G 8: 83,684,182 L267P probably damaging Het
Polr1a A G 6: 71,913,037 H80R probably damaging Het
Rag1 G T 2: 101,642,955 A614E possibly damaging Het
Ryr1 T C 7: 29,036,128 D4075G probably damaging Het
Sdk2 C A 11: 113,868,033 R455L probably damaging Het
Smoc2 A G 17: 14,368,965 N232S probably benign Het
Snd1 T C 6: 28,545,525 L360P probably damaging Het
Tmem26 T A 10: 68,751,266 F181L probably damaging Het
Tnrc6a A G 7: 123,186,619 M1512V probably benign Het
Tsc22d1 T A 14: 76,418,412 I20N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r122 T C 7: 21,134,098 T11A possibly damaging Het
Vpreb1 A T 16: 16,868,728 Y99* probably null Het
Wnt9b A T 11: 103,731,228 probably null Het
Zfp143 A G 7: 110,094,352 E604G probably damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGAATGCAATGGCTACGC -3'
(R):5'- GGCCCATGAATTGTTGCATATC -3'

Sequencing Primer
(F):5'- ACGCCTCCTATGTCTGCAG -3'
(R):5'- CTACCAACTCTGTGAGTAATGAGTC -3'
Posted On2017-03-31