Incidental Mutation 'R5219:Rcor3'
ID470638
Institutional Source Beutler Lab
Gene Symbol Rcor3
Ensembl Gene ENSMUSG00000037395
Gene NameREST corepressor 3
SynonymsE130101E15Rik, C730034D20Rik, 4921514E24Rik
MMRRC Submission 042792-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R5219 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location192098546-192138062 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to A at 192137513 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073279] [ENSMUST00000110849] [ENSMUST00000192128] [ENSMUST00000192158] [ENSMUST00000192491] [ENSMUST00000192866] [ENSMUST00000193144]
Predicted Effect probably benign
Transcript: ENSMUST00000073279
SMART Domains Protein: ENSMUSP00000073004
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 349 363 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110849
SMART Domains Protein: ENSMUSP00000106473
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191866
Predicted Effect probably benign
Transcript: ENSMUST00000192128
SMART Domains Protein: ENSMUSP00000141637
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192158
SMART Domains Protein: ENSMUSP00000141841
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 98 6.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192491
SMART Domains Protein: ENSMUSP00000141753
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192866
SMART Domains Protein: ENSMUSP00000142054
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193144
SMART Domains Protein: ENSMUSP00000142001
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
ELM2 1 54 1.8e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195083
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700063H04Rik A G 6: 122,392,340 noncoding transcript Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
9330182L06Rik G T 5: 9,461,486 W949C probably damaging Het
A2m A G 6: 121,676,950 H1414R possibly damaging Het
A530064D06Rik G T 17: 48,163,350 D154E possibly damaging Het
Adam34 C T 8: 43,651,424 D395N probably benign Het
Agl A G 3: 116,778,721 V195A possibly damaging Het
Aip T C 19: 4,115,180 I230V probably benign Het
Akap10 A C 11: 61,922,791 S43A probably benign Het
Ap3d1 T C 10: 80,709,817 E1026G probably benign Het
Arid5b T A 10: 68,278,110 K32N probably benign Het
Atp6v0a2 C A 5: 124,713,185 N477K probably damaging Het
Atr A C 9: 95,881,238 I1062L probably damaging Het
Ces2h T C 8: 105,016,646 V171A probably damaging Het
Cnot2 A G 10: 116,506,310 probably null Het
Cpne3 A T 4: 19,526,366 L391H probably damaging Het
Ctdp1 A G 18: 80,447,460 L715P probably damaging Het
Dcxr T C 11: 120,725,488 probably benign Het
Dhtkd1 C T 2: 5,914,816 A585T probably benign Het
Fcgbp G A 7: 28,104,085 A1705T probably damaging Het
Galr1 A T 18: 82,393,985 V252D probably damaging Het
Gm11677 A G 11: 111,725,399 noncoding transcript Het
Gp6 A G 7: 4,368,999 V252A possibly damaging Het
Inpp4b T C 8: 81,884,156 V176A probably benign Het
Irx2 G C 13: 72,631,301 A235P probably damaging Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lars A T 18: 42,234,720 V431E probably benign Het
Lmntd2 T C 7: 141,211,474 probably null Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Ltbp4 A T 7: 27,327,321 W500R probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Nadk A G 4: 155,584,254 I127M probably benign Het
Nxph1 T A 6: 9,247,765 Y245* probably null Het
Olfr1246 C T 2: 89,590,702 V138I probably benign Het
Olfr827 T A 10: 130,210,924 T69S possibly damaging Het
Olfr831-ps1 T C 9: 18,932,694 probably benign Het
Olfr954 G T 9: 39,462,267 V276L probably benign Het
Orc1 T C 4: 108,590,769 F71S probably damaging Het
Pccb A T 9: 100,985,209 Y404* probably null Het
Pde2a A C 7: 101,504,604 I460L probably damaging Het
Ppp3cb G T 14: 20,528,195 C162* probably null Het
Prickle2 T C 6: 92,376,530 S652G probably benign Het
Prss38 A G 11: 59,375,483 probably benign Het
Rgp1 C T 4: 43,579,440 A16V probably damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scnn1g T A 7: 121,766,266 Y514N probably damaging Het
Sephs1 A G 2: 4,891,690 D134G probably benign Het
Slc38a3 A G 9: 107,651,912 probably benign Het
Slc6a1 A T 6: 114,310,221 M388L probably benign Het
Ssbp3 A T 4: 107,047,458 N350I probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Sult1e1 A T 5: 87,578,586 I223N probably damaging Het
Tcf20 C A 15: 82,856,381 G290C probably damaging Het
Tekt2 G T 4: 126,322,264 T412K possibly damaging Het
Trabd2b A G 4: 114,602,810 T382A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 C A 4: 139,477,232 Y4818* probably null Het
Vmn1r204 A T 13: 22,556,899 R233S probably damaging Het
Vmn1r86 A G 7: 13,102,455 Y165H probably damaging Het
Yaf2 A C 15: 93,285,474 C152G probably benign Het
Zfp804b A T 5: 6,770,703 F751I probably benign Het
Other mutations in Rcor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Rcor3 APN 1 192127971 unclassified probably benign
IGL01688:Rcor3 APN 1 192123600 missense probably damaging 1.00
IGL01905:Rcor3 APN 1 192101002 missense probably damaging 1.00
R0523:Rcor3 UTSW 1 192130436 missense probably damaging 1.00
R1305:Rcor3 UTSW 1 192116346 missense possibly damaging 0.50
R1847:Rcor3 UTSW 1 192100833 missense possibly damaging 0.83
R1850:Rcor3 UTSW 1 192120111 missense probably benign
R3938:Rcor3 UTSW 1 192101085 missense possibly damaging 0.92
R4403:Rcor3 UTSW 1 192119912 splice site probably null
R4590:Rcor3 UTSW 1 192125917 missense probably damaging 1.00
R4750:Rcor3 UTSW 1 192130449 missense probably damaging 1.00
R5617:Rcor3 UTSW 1 192120130 missense probably benign 0.09
R6059:Rcor3 UTSW 1 192119940 missense probably benign 0.21
R6156:Rcor3 UTSW 1 192127842 unclassified probably benign
R6250:Rcor3 UTSW 1 192100896 missense probably damaging 1.00
R6258:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6260:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6808:Rcor3 UTSW 1 192137882 missense possibly damaging 0.79
R7194:Rcor3 UTSW 1 192125961 missense possibly damaging 0.88
R7387:Rcor3 UTSW 1 192137524 start gained probably benign
R7402:Rcor3 UTSW 1 192127983 missense probably benign 0.00
R7407:Rcor3 UTSW 1 192101672 missense probably benign
R7432:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7451:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7452:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7570:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7571:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7572:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7718:Rcor3 UTSW 1 192101721 missense probably benign 0.00
R7729:Rcor3 UTSW 1 192101778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACCTTGCCATGCACAC -3'
(R):5'- TTACTGGGGAAGAGCCGATC -3'

Sequencing Primer
(F):5'- ACGCCCTGTGTCACTGC -3'
(R):5'- TGCACTTCTCGGAGCCC -3'
Posted On2017-03-31