Incidental Mutation 'R5967:AI464131'
ID470650
Institutional Source Beutler Lab
Gene Symbol AI464131
Ensembl Gene ENSMUSG00000046312
Gene Nameexpressed sequence AI464131
SynonymsNET37
MMRRC Submission 043248-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5967 (G1)
Quality Score200
Status Not validated
Chromosome4
Chromosomal Location41495604-41503076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41497830 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 600 (A600V)
Ref Sequence ENSEMBL: ENSMUSP00000059038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054920] [ENSMUST00000149596]
Predicted Effect probably benign
Transcript: ENSMUST00000054920
AA Change: A600V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312
AA Change: A600V

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,712,358 G192W probably damaging Het
Agl T A 3: 116,793,708 D66V probably benign Het
Agrn G A 4: 156,175,103 P792S probably damaging Het
Angptl2 A G 2: 33,228,706 N164S probably damaging Het
Birc6 T C 17: 74,660,439 F4112L probably damaging Het
C8b A G 4: 104,793,333 E446G possibly damaging Het
Ceacam1 C T 7: 25,474,742 V163I probably damaging Het
Cngb1 T C 8: 95,251,906 K1068R probably damaging Het
Gna11 A G 10: 81,530,809 Y356H probably benign Het
Gnl2 A G 4: 125,041,030 M160V probably benign Het
Gpsm1 A G 2: 26,340,534 probably null Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Kif20a G T 18: 34,630,527 R609L probably benign Het
Meis2 G A 2: 115,864,309 T444I probably benign Het
Muc3 T A 5: 137,146,637 I62L probably benign Het
Ncor2 C T 5: 125,068,984 D526N unknown Het
Nodal G T 10: 61,423,667 E294D probably damaging Het
Nup214 T C 2: 31,979,778 V161A possibly damaging Het
Olfr1029 G A 2: 85,976,191 R316H probably benign Het
Olfr172 G T 16: 58,760,362 D271E probably damaging Het
Olfr514 C T 7: 108,825,714 G95D probably benign Het
Pclo A T 5: 14,540,655 T990S unknown Het
Piwil2 A T 14: 70,390,564 M752K probably benign Het
Ppargc1b A G 18: 61,298,766 S1004P probably damaging Het
Prkd1 A T 12: 50,364,550 M805K probably damaging Het
Rad23a T C 8: 84,838,939 E30G probably damaging Het
Ralbp1 A G 17: 65,864,279 V233A probably benign Het
Scin C T 12: 40,077,538 E418K probably benign Het
Scn7a T A 2: 66,675,713 I1611F probably damaging Het
Slit2 A T 5: 47,985,164 H42L probably damaging Het
Stard9 T A 2: 120,706,894 V4259D probably damaging Het
Trhde T A 10: 114,567,134 Y528F probably damaging Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Zfp715 T C 7: 43,299,148 T463A probably benign Het
Other mutations in AI464131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:AI464131 APN 4 41498923 missense possibly damaging 0.68
IGL01352:AI464131 APN 4 41499469 nonsense probably null
IGL01384:AI464131 APN 4 41498151 missense probably damaging 0.99
IGL02150:AI464131 APN 4 41499183 missense possibly damaging 0.48
IGL02557:AI464131 APN 4 41497900 missense possibly damaging 0.51
R0238:AI464131 UTSW 4 41498912 missense probably benign 0.11
R0238:AI464131 UTSW 4 41498912 missense probably benign 0.11
R0413:AI464131 UTSW 4 41498585 missense probably benign 0.00
R0455:AI464131 UTSW 4 41499538 nonsense probably null
R0511:AI464131 UTSW 4 41498538 missense probably damaging 0.96
R0560:AI464131 UTSW 4 41498167 missense probably damaging 0.99
R0785:AI464131 UTSW 4 41497539 missense probably benign 0.02
R0940:AI464131 UTSW 4 41497996 missense probably damaging 1.00
R1677:AI464131 UTSW 4 41497947 missense probably benign 0.00
R1762:AI464131 UTSW 4 41498553 missense possibly damaging 0.91
R1984:AI464131 UTSW 4 41497501 missense possibly damaging 0.95
R2192:AI464131 UTSW 4 41497704 missense probably damaging 0.99
R2496:AI464131 UTSW 4 41499165 missense probably benign 0.28
R4212:AI464131 UTSW 4 41498307 missense probably benign 0.01
R4321:AI464131 UTSW 4 41498767 missense probably benign 0.00
R4672:AI464131 UTSW 4 41499061 missense probably benign 0.00
R4890:AI464131 UTSW 4 41498877 missense probably benign 0.00
R4954:AI464131 UTSW 4 41498241 missense possibly damaging 0.89
R5177:AI464131 UTSW 4 41498407 nonsense probably null
R6005:AI464131 UTSW 4 41498895 missense probably benign 0.31
R6128:AI464131 UTSW 4 41498445 missense probably damaging 1.00
R6162:AI464131 UTSW 4 41497899 missense possibly damaging 0.51
R7202:AI464131 UTSW 4 41498268 missense probably damaging 0.99
R7211:AI464131 UTSW 4 41498028 missense probably damaging 1.00
R7311:AI464131 UTSW 4 41498577 missense probably damaging 1.00
R7524:AI464131 UTSW 4 41498779 missense probably benign 0.03
R7680:AI464131 UTSW 4 41497978 missense probably damaging 1.00
R8177:AI464131 UTSW 4 41497568 nonsense probably null
R8809:AI464131 UTSW 4 41498812 missense probably benign
X0024:AI464131 UTSW 4 41498107 missense possibly damaging 0.92
Z1088:AI464131 UTSW 4 41497557 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCACGCTCTTGCTTACCAGG -3'
(R):5'- GGGCTATCCGTTCATCTTGC -3'

Sequencing Primer
(F):5'- TGTCCCCGATGAGAAACTGTG -3'
(R):5'- TCATCTTGCCCGATATGATAGG -3'
Posted On2017-03-31